Incidental Mutation 'R5825:Jcad'
ID450147
Institutional Source Beutler Lab
Gene Symbol Jcad
Ensembl Gene ENSMUSG00000033960
Gene Namejunctional cadherin 5 associated
Synonyms9430020K01Rik
MMRRC Submission 044053-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5825 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location4634929-4682868 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 4674896 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 886 (V886E)
Ref Sequence ENSEMBL: ENSMUSP00000038613 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037029]
Predicted Effect probably benign
Transcript: ENSMUST00000037029
AA Change: V886E

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000038613
Gene: ENSMUSG00000033960
AA Change: V886E

DomainStartEndE-ValueType
Pfam:JCAD 1 1309 N/A PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.1%
  • 10x: 95.3%
  • 20x: 83.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1bg A T 15: 60,920,127 Y217* probably null Het
Abca2 A T 2: 25,436,736 I567F probably benign Het
Acss2 T A 2: 155,549,178 probably null Het
Atxn7l2 C A 3: 108,204,811 A320S probably damaging Het
Bfsp1 C T 2: 143,827,459 G400D probably benign Het
Ces5a G T 8: 93,525,667 A199D probably damaging Het
Chd2 A T 7: 73,484,602 probably null Het
Crebbp A G 16: 4,087,742 V1705A probably damaging Het
Cyp2j8 T A 4: 96,507,214 Q58L probably benign Het
Dlec1 T A 9: 119,142,968 I1379N probably damaging Het
Dnah9 T C 11: 66,126,601 H593R probably benign Het
Ep300 T A 15: 81,611,472 C412S probably benign Het
Fam110a A G 2: 151,970,041 S270P probably damaging Het
Gcc2 A G 10: 58,294,821 T1412A probably damaging Het
Gm4788 T A 1: 139,774,598 probably null Het
Helz2 T C 2: 181,232,656 E2015G probably benign Het
Hormad1 T C 3: 95,562,559 V39A probably damaging Het
Igf2 G T 7: 142,653,855 H168Q probably damaging Het
Il18rap A G 1: 40,531,566 T223A probably benign Het
Itpr2 T C 6: 146,144,149 E2573G probably damaging Het
Klra1 T C 6: 130,380,629 R12G probably damaging Het
Lamb1 A G 12: 31,318,614 I1248V probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Mapk7 C T 11: 61,490,381 R465Q possibly damaging Het
Mogs T C 6: 83,118,212 V670A possibly damaging Het
Mroh2a C T 1: 88,230,680 R150* probably null Het
Ninl A T 2: 150,940,724 I1182N probably damaging Het
Nup160 A G 2: 90,679,770 probably null Het
Nynrin A G 14: 55,864,226 R451G probably benign Het
Olfr1126 A G 2: 87,457,450 D95G probably benign Het
Olfr190 T C 16: 59,074,661 I140V probably benign Het
Osbp A G 19: 11,970,721 T131A probably damaging Het
Pcdhga12 A C 18: 37,768,503 D796A possibly damaging Het
Pcdhgb8 G A 18: 37,762,236 V120I probably benign Het
Pdgfb A T 15: 79,997,668 V213E probably benign Het
Phldb2 T C 16: 45,763,097 M1013V probably benign Het
Pnmal1 A G 7: 16,961,095 S292G probably benign Het
Prrt4 A G 6: 29,177,183 S196P probably benign Het
Rap1gds1 T C 3: 138,955,375 M463V possibly damaging Het
Tmprss11g A T 5: 86,498,533 S58R probably damaging Het
Traf3 C A 12: 111,255,361 Q319K probably benign Het
Trappc8 C T 18: 20,873,920 V194M probably damaging Het
Tyw1 A G 5: 130,268,088 K182R probably damaging Het
Usp48 A G 4: 137,623,378 T585A probably benign Het
Xkr6 G T 14: 63,819,032 V387L probably benign Het
Yod1 T C 1: 130,719,006 W207R probably damaging Het
Zdhhc8 T C 16: 18,228,674 S63G probably null Het
Zfp827 A G 8: 79,179,016 E874G probably damaging Het
Zfy1 T A Y: 726,531 K411N possibly damaging Het
Other mutations in Jcad
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00650:Jcad APN 18 4675692 missense probably benign 0.14
IGL00672:Jcad APN 18 4674835 missense possibly damaging 0.77
IGL00782:Jcad APN 18 4675073 missense probably benign 0.00
IGL00825:Jcad APN 18 4673516 missense probably damaging 1.00
IGL01522:Jcad APN 18 4673312 missense probably damaging 0.97
IGL01796:Jcad APN 18 4672855 nonsense probably null
IGL01973:Jcad APN 18 4675514 missense probably benign 0.21
IGL02083:Jcad APN 18 4680266 utr 3 prime probably benign
IGL02625:Jcad APN 18 4674422 missense probably benign 0.03
IGL03002:Jcad APN 18 4675153 missense probably benign 0.00
IGL03325:Jcad APN 18 4673902 missense probably benign
R0304:Jcad UTSW 18 4673325 missense possibly damaging 0.75
R0487:Jcad UTSW 18 4673243 missense probably damaging 1.00
R0519:Jcad UTSW 18 4649122 start gained probably benign
R0664:Jcad UTSW 18 4676063 missense probably damaging 0.97
R1649:Jcad UTSW 18 4673309 missense probably damaging 1.00
R1710:Jcad UTSW 18 4674511 missense probably damaging 1.00
R1734:Jcad UTSW 18 4674526 missense probably damaging 1.00
R1823:Jcad UTSW 18 4675780 missense probably damaging 1.00
R1824:Jcad UTSW 18 4649293 missense probably benign
R1850:Jcad UTSW 18 4675730 missense possibly damaging 0.95
R1872:Jcad UTSW 18 4673048 missense probably benign
R1878:Jcad UTSW 18 4673857 missense possibly damaging 0.60
R1918:Jcad UTSW 18 4674292 missense probably damaging 1.00
R1967:Jcad UTSW 18 4675162 missense probably benign 0.07
R2420:Jcad UTSW 18 4675952 missense probably damaging 1.00
R2504:Jcad UTSW 18 4674026 missense probably damaging 0.99
R2936:Jcad UTSW 18 4675153 missense probably benign 0.00
R4420:Jcad UTSW 18 4676032 missense probably benign 0.00
R4668:Jcad UTSW 18 4680221 splice site probably null
R4670:Jcad UTSW 18 4674175 missense probably benign 0.03
R4671:Jcad UTSW 18 4674175 missense probably benign 0.03
R4707:Jcad UTSW 18 4649338 nonsense probably null
R4720:Jcad UTSW 18 4674055 missense probably benign 0.03
R4815:Jcad UTSW 18 4675223 missense possibly damaging 0.94
R4906:Jcad UTSW 18 4673762 missense probably damaging 1.00
R5214:Jcad UTSW 18 4674134 missense probably damaging 1.00
R5439:Jcad UTSW 18 4675790 missense probably damaging 1.00
R5563:Jcad UTSW 18 4673944 missense possibly damaging 0.93
R5721:Jcad UTSW 18 4676044 missense possibly damaging 0.48
R5952:Jcad UTSW 18 4674554 missense probably damaging 1.00
R6661:Jcad UTSW 18 4675256 missense probably damaging 1.00
R6928:Jcad UTSW 18 4673372 missense probably benign 0.00
T0722:Jcad UTSW 18 4675531 missense probably benign 0.25
X0017:Jcad UTSW 18 4676044 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CGGCCCTGGGATTTGATAAGTC -3'
(R):5'- GCTAAAGTCTCGCTCACACATC -3'

Sequencing Primer
(F):5'- CCCTGGGATTTGATAAGTCAGTTAG -3'
(R):5'- ACATCCCATTCAAATCCTCCTGG -3'
Posted On2016-12-20