Incidental Mutation 'R5826:Plcg2'
ID450175
Institutional Source Beutler Lab
Gene Symbol Plcg2
Ensembl Gene ENSMUSG00000034330
Gene Namephospholipase C, gamma 2
SynonymsPlcg-2, PLCgamma2
MMRRC Submission 043217-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5826 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location117498291-117635142 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 117610844 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 985 (V985A)
Ref Sequence ENSEMBL: ENSMUSP00000079991 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081232]
PDB Structure
Crystal structure of the N-terminal SH2 domain of mouse phospholipase C-gamma 2 [X-RAY DIFFRACTION]
Solution structure of the SH3 domain from Phospholipase C, gamma 2 [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000081232
AA Change: V985A

PolyPhen 2 Score 0.194 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000079991
Gene: ENSMUSG00000034330
AA Change: V985A

DomainStartEndE-ValueType
PH 21 133 1.87e-4 SMART
PLCXc 312 456 2.29e-96 SMART
low complexity region 461 476 N/A INTRINSIC
PDB:2K2J|A 478 516 6e-17 PDB
SH2 530 623 2.24e-30 SMART
SH2 644 726 1.16e-28 SMART
SH3 772 828 3.12e-18 SMART
PH 789 910 4.31e0 SMART
PLCYc 930 1044 1.18e-66 SMART
C2 1062 1167 1.41e-15 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transmembrane signaling enzyme that catalyzes the conversion of 1-phosphatidyl-1D-myo-inositol 4,5-bisphosphate to 1D-myo-inositol 1,4,5-trisphosphate (IP3) and diacylglycerol (DAG) using calcium as a cofactor. IP3 and DAG are second messenger molecules important for transmitting signals from growth factor receptors and immune system receptors across the cell membrane. Mutations in this gene have been found in autoinflammation, antibody deficiency, and immune dysregulation syndrome and familial cold autoinflammatory syndrome 3. [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygotes for some null alleles show decreased B cell and impaired NK cell function. Other homozygous null alleles show aberrant separation of blood and lymphatic vessels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik C A 17: 33,065,314 R838I possibly damaging Het
Abca13 A G 11: 9,682,056 H4992R probably damaging Het
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Akr1c20 T C 13: 4,510,223 E152G probably damaging Het
Ano4 T A 10: 88,952,327 D877V probably damaging Het
Asb18 A C 1: 90,014,538 S14A probably damaging Het
Atrnl1 T A 19: 57,630,292 Y147* probably null Het
Cbfa2t2 A G 2: 154,500,455 I30M possibly damaging Het
Cpd A T 11: 76,784,416 L1293* probably null Het
Csmd2 T C 4: 128,519,199 probably null Het
Cst9 G A 2: 148,838,473 V120I possibly damaging Het
Ddah2 A G 17: 35,060,688 D128G probably damaging Het
Defb11 T C 8: 21,905,494 I56V probably benign Het
Dnah17 A T 11: 118,034,367 L3880Q probably damaging Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Dopey1 A G 9: 86,507,570 T508A possibly damaging Het
Ephb2 T A 4: 136,660,737 H685L probably damaging Het
Glrb T C 3: 80,845,142 Y387C probably damaging Het
Gucy2e A G 11: 69,236,033 S205P possibly damaging Het
Has2 T A 15: 56,668,102 I406F probably damaging Het
Hcrtr2 A C 9: 76,323,287 V73G probably benign Het
Hsd17b4 A T 18: 50,183,172 Q622L probably benign Het
Nlrp1b A T 11: 71,181,196 M607K probably benign Het
Nol6 T A 4: 41,122,158 D184V probably benign Het
Noxa1 T A 2: 25,086,241 Q345L probably damaging Het
Nudt6 T C 3: 37,419,468 T35A probably benign Het
Plxnc1 C T 10: 94,799,473 probably null Het
Prkdc G A 16: 15,734,098 R2056H probably benign Het
Ptpn4 A T 1: 119,684,516 I49N probably benign Het
Ralgapa1 T G 12: 55,677,113 S1543R probably damaging Het
Rnf135 A T 11: 80,199,086 N416I probably damaging Het
Scn5a A G 9: 119,521,333 L825P probably damaging Het
Sept11 A T 5: 93,139,450 N8I possibly damaging Het
Slc13a3 T C 2: 165,408,956 I456V probably benign Het
Slc16a3 A G 11: 120,956,930 T315A probably benign Het
Sun1 T G 5: 139,245,416 F657C probably damaging Het
Tmco3 T C 8: 13,310,314 S34P probably damaging Het
Tnrc18 G A 5: 142,773,747 P778L unknown Het
Ubxn4 A C 1: 128,266,321 K284T possibly damaging Het
Usp37 A T 1: 74,470,626 N461K probably damaging Het
Vmn2r106 A T 17: 20,278,871 F259L probably benign Het
Vmn2r73 T C 7: 85,875,748 D64G possibly damaging Het
Other mutations in Plcg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00594:Plcg2 APN 8 117556071 missense possibly damaging 0.89
IGL00911:Plcg2 APN 8 117586515 missense probably benign 0.17
IGL00952:Plcg2 APN 8 117607217 missense probably benign
IGL01115:Plcg2 APN 8 117557329 missense probably damaging 1.00
IGL01326:Plcg2 APN 8 117573999 splice site probably benign
IGL01357:Plcg2 APN 8 117614161 splice site probably benign
IGL01705:Plcg2 APN 8 117581662 missense probably damaging 1.00
IGL01755:Plcg2 APN 8 117621241 missense possibly damaging 0.48
IGL01828:Plcg2 APN 8 117590233 missense probably damaging 1.00
IGL02307:Plcg2 APN 8 117579896 critical splice donor site probably null
IGL02345:Plcg2 APN 8 117585180 missense probably damaging 0.99
IGL02448:Plcg2 APN 8 117607221 missense probably benign
IGL02587:Plcg2 APN 8 117558113 missense possibly damaging 0.80
IGL02646:Plcg2 APN 8 117603883 missense possibly damaging 0.88
IGL03409:Plcg2 APN 8 117583495 missense probably damaging 0.96
Poseidon UTSW 8 117615238 missense probably damaging 1.00
Poseidon2 UTSW 8 117577874 missense possibly damaging 0.80
queen UTSW 8 117581707 missense probably benign 0.00
Theseus UTSW 8 117596332 missense probably damaging 0.99
trident UTSW 8 117612978 missense probably benign 0.00
R0172:Plcg2 UTSW 8 117579782 missense probably benign 0.00
R0194:Plcg2 UTSW 8 117573397 splice site probably benign
R0410:Plcg2 UTSW 8 117615373 missense probably damaging 0.98
R0462:Plcg2 UTSW 8 117585305 missense probably benign 0.06
R0494:Plcg2 UTSW 8 117556104 missense probably damaging 1.00
R0522:Plcg2 UTSW 8 117614288 splice site probably null
R0612:Plcg2 UTSW 8 117573365 missense probably benign 0.01
R1239:Plcg2 UTSW 8 117556044 missense probably benign
R1367:Plcg2 UTSW 8 117615238 missense probably damaging 1.00
R1608:Plcg2 UTSW 8 117614235 missense possibly damaging 0.89
R1756:Plcg2 UTSW 8 117592708 missense probably benign 0.02
R2176:Plcg2 UTSW 8 117612994 missense probably damaging 1.00
R3500:Plcg2 UTSW 8 117612978 missense probably benign 0.00
R4043:Plcg2 UTSW 8 117612978 missense probably benign 0.00
R4654:Plcg2 UTSW 8 117504315 missense probably benign
R4883:Plcg2 UTSW 8 117607133 nonsense probably null
R4932:Plcg2 UTSW 8 117607083 missense probably benign 0.05
R5080:Plcg2 UTSW 8 117590003 missense probably benign 0.10
R5226:Plcg2 UTSW 8 117577874 missense possibly damaging 0.80
R5264:Plcg2 UTSW 8 117634793 missense possibly damaging 0.95
R5298:Plcg2 UTSW 8 117605249 missense probably benign
R5473:Plcg2 UTSW 8 117634401 missense probably benign
R5555:Plcg2 UTSW 8 117612995 nonsense probably null
R5557:Plcg2 UTSW 8 117586557 missense probably damaging 0.99
R5805:Plcg2 UTSW 8 117598495 critical splice donor site probably null
R5871:Plcg2 UTSW 8 117504217 missense probably damaging 1.00
R5894:Plcg2 UTSW 8 117504349 missense probably damaging 0.99
R6142:Plcg2 UTSW 8 117585271 missense probably benign
R6609:Plcg2 UTSW 8 117568170 missense probably benign 0.31
R6684:Plcg2 UTSW 8 117596332 missense probably damaging 0.99
R6710:Plcg2 UTSW 8 117557347 missense probably benign 0.05
R6931:Plcg2 UTSW 8 117557319 missense probably benign 0.24
R6946:Plcg2 UTSW 8 117504190 missense probably benign
X0027:Plcg2 UTSW 8 117555983 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CCAGAAGTATGGTTGACTGTCTC -3'
(R):5'- AAGTGACATTGCTGGCCATG -3'

Sequencing Primer
(F):5'- TGAGGCCACATCTCTGAATAGTGC -3'
(R):5'- ACATTGCTGGCCATGACAGG -3'
Posted On2016-12-20