Incidental Mutation 'R0549:Cnpy4'
ID45018
Institutional Source Beutler Lab
Gene Symbol Cnpy4
Ensembl Gene ENSMUSG00000036968
Gene Namecanopy FGF signaling regulator 4
Synonyms
MMRRC Submission 038741-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.146) question?
Stock #R0549 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location138187485-138193918 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 138187637 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 18 (F18S)
Ref Sequence ENSEMBL: ENSMUSP00000106559 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048698] [ENSMUST00000110932] [ENSMUST00000110934] [ENSMUST00000110936] [ENSMUST00000110937] [ENSMUST00000123415] [ENSMUST00000139276] [ENSMUST00000153117]
Predicted Effect probably benign
Transcript: ENSMUST00000048698
SMART Domains Protein: ENSMUSP00000048016
Gene: ENSMUSG00000036980

DomainStartEndE-ValueType
TAF 12 78 1.44e-35 SMART
low complexity region 142 161 N/A INTRINSIC
low complexity region 179 197 N/A INTRINSIC
Pfam:DUF1546 308 399 1e-35 PFAM
low complexity region 466 476 N/A INTRINSIC
low complexity region 523 535 N/A INTRINSIC
low complexity region 542 578 N/A INTRINSIC
low complexity region 586 602 N/A INTRINSIC
low complexity region 615 646 N/A INTRINSIC
low complexity region 665 676 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110932
SMART Domains Protein: ENSMUSP00000106557
Gene: ENSMUSG00000036968

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Pfam:DUF3456 32 160 9.5e-37 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000110934
AA Change: F18S

PolyPhen 2 Score 0.629 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000106559
Gene: ENSMUSG00000036968
AA Change: F18S

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:DUF3456 43 202 3.4e-51 PFAM
low complexity region 218 230 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110936
SMART Domains Protein: ENSMUSP00000106561
Gene: ENSMUSG00000036980

DomainStartEndE-ValueType
TAF 12 78 1.44e-35 SMART
low complexity region 142 161 N/A INTRINSIC
low complexity region 179 197 N/A INTRINSIC
Pfam:TAF6_C 308 397 1.1e-33 PFAM
low complexity region 466 476 N/A INTRINSIC
low complexity region 523 535 N/A INTRINSIC
low complexity region 542 578 N/A INTRINSIC
low complexity region 586 602 N/A INTRINSIC
low complexity region 615 646 N/A INTRINSIC
low complexity region 665 676 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110937
SMART Domains Protein: ENSMUSP00000106562
Gene: ENSMUSG00000036980

DomainStartEndE-ValueType
TAF 12 78 1.44e-35 SMART
low complexity region 142 161 N/A INTRINSIC
low complexity region 179 197 N/A INTRINSIC
Pfam:DUF1546 308 399 1.9e-36 PFAM
low complexity region 466 476 N/A INTRINSIC
low complexity region 523 535 N/A INTRINSIC
low complexity region 542 549 N/A INTRINSIC
low complexity region 559 576 N/A INTRINSIC
low complexity region 606 615 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123415
SMART Domains Protein: ENSMUSP00000122534
Gene: ENSMUSG00000036980

DomainStartEndE-ValueType
TAF 12 78 1.44e-35 SMART
low complexity region 142 161 N/A INTRINSIC
low complexity region 179 197 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130126
Predicted Effect probably benign
Transcript: ENSMUST00000139276
SMART Domains Protein: ENSMUSP00000116512
Gene: ENSMUSG00000036980

DomainStartEndE-ValueType
Pfam:TAF 11 55 2.5e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153117
SMART Domains Protein: ENSMUSP00000138335
Gene: ENSMUSG00000036980

DomainStartEndE-ValueType
TAF 12 78 1.44e-35 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200483
Meta Mutation Damage Score 0.112 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 96% (48/50)
MGI Phenotype PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit male infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 A G 17: 46,322,290 F498L probably damaging Het
Adamts6 A T 13: 104,297,255 D64V possibly damaging Het
Agbl2 T C 2: 90,789,843 probably benign Het
Angptl3 A G 4: 99,031,455 S151G probably benign Het
Arhgap39 C T 15: 76,734,886 D833N probably damaging Het
C4b G T 17: 34,735,415 L927I probably damaging Het
Ccl3 T C 11: 83,648,336 T66A probably damaging Het
Cdh7 T C 1: 110,108,944 L618P probably damaging Het
Cfap65 T C 1: 74,918,444 T989A probably benign Het
Col6a5 A G 9: 105,904,579 probably benign Het
Dppa2 G A 16: 48,318,671 R289H probably benign Het
Evx2 T C 2: 74,659,134 T96A probably benign Het
Frmd4a A G 2: 4,603,967 E577G possibly damaging Het
Gcgr G A 11: 120,536,561 G166S probably benign Het
Gm4788 A T 1: 139,739,488 D377E probably damaging Het
Gm5316 T C 6: 122,900,191 noncoding transcript Het
Gria1 G A 11: 57,228,973 R292Q probably damaging Het
Hars2 T A 18: 36,786,208 probably null Het
Hkdc1 T A 10: 62,400,240 T508S probably benign Het
Kif2b A T 11: 91,576,584 I291N probably damaging Het
Lmbrd1 A T 1: 24,744,920 T377S probably benign Het
Lrrc28 A G 7: 67,628,342 probably benign Het
Mmp3 A T 9: 7,455,638 N463I probably benign Het
Myh6 A G 14: 54,958,608 F578S probably damaging Het
Ncbp1 T A 4: 46,168,476 M608K possibly damaging Het
Nf1 T C 11: 79,468,771 F1412L probably damaging Het
Nlrp5 T A 7: 23,441,802 W1083R probably damaging Het
Nrsn1 T C 13: 25,262,258 Y45C probably benign Het
Olfr401 T G 11: 74,121,475 M62R probably damaging Het
Osbpl7 G T 11: 97,067,542 R881L probably damaging Het
Papss1 A G 3: 131,619,213 E456G possibly damaging Het
Pbxip1 T A 3: 89,443,592 probably benign Het
Pcca A G 14: 122,638,377 probably benign Het
Pde1a T A 2: 79,865,070 N511I probably damaging Het
Prpf39 A T 12: 65,056,256 I435F probably benign Het
Rnf213 C T 11: 119,465,082 T4117M probably damaging Het
Sel1l2 A T 2: 140,265,882 M216K probably damaging Het
Sidt2 A G 9: 45,953,119 probably null Het
Sirt3 A T 7: 140,869,487 probably null Het
Smpd4 T C 16: 17,639,312 V378A probably benign Het
Svil T A 18: 5,064,566 S642T possibly damaging Het
Tcp10a A G 17: 7,326,551 K92E probably benign Het
Tmem144 T C 3: 79,822,744 D233G probably damaging Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Tnik T C 3: 28,570,920 S335P possibly damaging Het
Ush2a T C 1: 188,946,953 L4786P probably damaging Het
Utp11 A T 4: 124,686,079 probably benign Het
Vmn1r67 A G 7: 10,447,714 N241D probably damaging Het
Vmn2r11 A T 5: 109,052,097 C497S possibly damaging Het
Other mutations in Cnpy4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02247:Cnpy4 APN 5 138192863 missense probably benign 0.00
R0317:Cnpy4 UTSW 5 138192812 nonsense probably null
R0525:Cnpy4 UTSW 5 138192616 missense probably benign 0.45
R0568:Cnpy4 UTSW 5 138192577 missense probably damaging 1.00
R1889:Cnpy4 UTSW 5 138192840 missense probably benign 0.06
R2285:Cnpy4 UTSW 5 138192825 unclassified probably null
R4272:Cnpy4 UTSW 5 138192591 missense probably damaging 0.98
R6682:Cnpy4 UTSW 5 138187722 critical splice donor site probably null
X0065:Cnpy4 UTSW 5 138192592 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- TCACGGATACACCTCAGACTTTCCC -3'
(R):5'- TTCAGCCTAGAGTTAGAGAGGCAGG -3'

Sequencing Primer
(F):5'- TGTCAGGACCTTCAGAAGGC -3'
(R):5'- CTAGAGTTAGAGAGGCAGGAGGTAG -3'
Posted On2013-06-11