Incidental Mutation 'R5827:P2rx2'
ID450212
Institutional Source Beutler Lab
Gene Symbol P2rx2
Ensembl Gene ENSMUSG00000029503
Gene Namepurinergic receptor P2X, ligand-gated ion channel, 2
SynonymsP2x2, P2X2a
MMRRC Submission 043218-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5827 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location110339812-110343212 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 110340329 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 453 (R453Q)
Ref Sequence ENSEMBL: ENSMUSP00000054233 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007296] [ENSMUST00000058016] [ENSMUST00000112478] [ENSMUST00000112481] [ENSMUST00000185691] [ENSMUST00000186408] [ENSMUST00000195985] [ENSMUST00000200037] [ENSMUST00000200214]
Predicted Effect probably benign
Transcript: ENSMUST00000007296
SMART Domains Protein: ENSMUSP00000007296
Gene: ENSMUSG00000007080

DomainStartEndE-ValueType
POLBc 267 870 9.42e-97 SMART
Blast:POLBc 903 970 1e-28 BLAST
Blast:POLBc 1014 1073 2e-22 BLAST
Blast:POLBc 1195 1266 7e-21 BLAST
low complexity region 1275 1294 N/A INTRINSIC
Blast:DUF1744 1401 1430 2e-7 BLAST
DUF1744 1524 1924 1.9e-236 SMART
coiled coil region 1936 1963 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000058016
AA Change: R453Q

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000054233
Gene: ENSMUSG00000029503
AA Change: R453Q

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:P2X_receptor 27 388 1.5e-149 PFAM
low complexity region 419 436 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112478
SMART Domains Protein: ENSMUSP00000108097
Gene: ENSMUSG00000029503

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:P2X_receptor 27 395 4e-144 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112481
SMART Domains Protein: ENSMUSP00000108100
Gene: ENSMUSG00000007080

DomainStartEndE-ValueType
Pfam:DUF1744 13 48 2.7e-13 PFAM
coiled coil region 60 87 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141506
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152495
Predicted Effect probably benign
Transcript: ENSMUST00000185691
SMART Domains Protein: ENSMUSP00000139397
Gene: ENSMUSG00000072754

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Colipase-like 26 85 3.8e-19 PFAM
Pfam:Colipase-like 66 155 3.2e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000186408
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190060
Predicted Effect probably benign
Transcript: ENSMUST00000195985
AA Change: R441Q

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000143047
Gene: ENSMUSG00000029503
AA Change: R441Q

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:P2X_receptor 27 393 7.4e-144 PFAM
low complexity region 419 436 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199165
Predicted Effect probably benign
Transcript: ENSMUST00000200037
SMART Domains Protein: ENSMUSP00000143554
Gene: ENSMUSG00000029503

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:P2X_receptor 27 388 5.5e-149 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000200214
AA Change: R354Q

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000142567
Gene: ENSMUSG00000029503
AA Change: R354Q

DomainStartEndE-ValueType
Pfam:P2X_receptor 1 306 1.3e-117 PFAM
low complexity region 332 349 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the family of purinoceptors for ATP. This receptor functions as a ligand-gated ion channel. Binding to ATP mediates synaptic transmission between neurons and from neurons to smooth muscle. Multiple transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Aug 2013]
PHENOTYPE: Homozygous mutant mice are viable and show no gross pathology. Mice show abnormal ventilatory and electrophysiological responses to hypoxia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b C A 11: 109,977,813 G175V probably damaging Het
Agl T C 3: 116,781,054 I34V probably damaging Het
Cavin4 A T 4: 48,672,074 D173V probably damaging Het
Chd9 A G 8: 90,989,450 D884G probably damaging Het
Col6a5 G A 9: 105,928,120 R1196* probably null Het
Disc1 T C 8: 125,135,365 L492P probably damaging Het
Dscam A G 16: 96,649,991 probably null Het
Fbxw4 T C 19: 45,579,657 T26A probably benign Het
Hist1h1t A G 13: 23,696,202 K113E possibly damaging Het
Klhl24 T A 16: 20,120,121 Y475* probably null Het
Map4k3 C T 17: 80,593,283 probably null Het
Mfsd6 T C 1: 52,662,392 E633G probably damaging Het
Mycn G A 12: 12,939,793 R201* probably null Het
Nek11 T C 9: 105,314,745 I155M probably damaging Het
Notch2 G A 3: 98,072,862 V231I possibly damaging Het
Npnt A C 3: 132,906,775 V187G possibly damaging Het
Nr1d2 C A 14: 18,222,248 V8L possibly damaging Het
Nup188 C T 2: 30,339,847 T1359I probably damaging Het
Olfr1029 C A 2: 85,975,306 P21Q probably benign Het
Olfr1277 A T 2: 111,269,921 W149R probably damaging Het
Olfr164 T A 16: 19,286,432 I104L probably benign Het
Olfr957 T A 9: 39,511,058 I221F probably damaging Het
Pcdhb7 A G 18: 37,342,024 E71G probably benign Het
Pcdhb9 A T 18: 37,401,958 D335V possibly damaging Het
Pcsk9 C T 4: 106,448,947 G368R probably damaging Het
Ptgr2 G A 12: 84,295,336 probably null Het
Rhebl1 T A 15: 98,878,270 I168F probably damaging Het
Serpina3b A G 12: 104,130,777 T106A probably benign Het
Sh3pxd2b A G 11: 32,422,422 I530V probably benign Het
Skint10 T C 4: 112,746,775 T72A probably benign Het
Slx4 G T 16: 4,001,284 F8L possibly damaging Het
Tdp2 T C 13: 24,831,853 L41P probably damaging Het
Tiam2 A G 17: 3,448,489 I847V probably benign Het
Tmem200c A G 17: 68,842,009 E529G probably benign Het
Tnpo1 T C 13: 98,856,908 D590G probably damaging Het
Ube2cbp T C 9: 86,372,436 T331A possibly damaging Het
Ugt1a2 T A 1: 88,201,065 S143R probably damaging Het
Zfp58 A T 13: 67,491,293 C360S probably damaging Het
Other mutations in P2rx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02332:P2rx2 APN 5 110341805 missense probably benign 0.22
IGL02523:P2rx2 APN 5 110342042 missense probably damaging 0.98
IGL02535:P2rx2 APN 5 110342353 missense probably benign 0.02
IGL02663:P2rx2 APN 5 110340249 missense possibly damaging 0.84
IGL02663:P2rx2 APN 5 110340186 unclassified probably null
IGL02756:P2rx2 APN 5 110342410 splice site probably benign
IGL03177:P2rx2 APN 5 110341613 missense probably damaging 1.00
R0382:P2rx2 UTSW 5 110341179 missense probably benign 0.25
R2092:P2rx2 UTSW 5 110341141 missense probably damaging 1.00
R2104:P2rx2 UTSW 5 110341141 missense probably damaging 1.00
R2226:P2rx2 UTSW 5 110342879 missense probably damaging 0.98
R2395:P2rx2 UTSW 5 110341661 missense probably damaging 1.00
R4854:P2rx2 UTSW 5 110340927 missense probably damaging 0.99
R4863:P2rx2 UTSW 5 110341568 missense probably benign 0.23
R5125:P2rx2 UTSW 5 110342651 missense possibly damaging 0.59
R5250:P2rx2 UTSW 5 110341588 missense probably damaging 0.98
R5366:P2rx2 UTSW 5 110341828 missense probably damaging 1.00
R5559:P2rx2 UTSW 5 110340561 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- CAGATCCAGGTCTGTAGCTTAG -3'
(R):5'- AGGGCTCCTTTCTGTGTGAC -3'

Sequencing Primer
(F):5'- ATCCAGGTCTGTAGCTTAGTGAGG -3'
(R):5'- GCTCTACAGCCATAAGAAGTTCG -3'
Posted On2016-12-20