Incidental Mutation 'R5827:Ube2cbp'
ID450216
Institutional Source Beutler Lab
Gene Symbol Ube2cbp
Ensembl Gene ENSMUSG00000032415
Gene Nameubiquitin-conjugating enzyme E2C binding protein
Synonyms2610018I03Rik
MMRRC Submission 043218-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.803) question?
Stock #R5827 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location86307306-86464950 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 86372436 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 331 (T331A)
Ref Sequence ENSEMBL: ENSMUSP00000034986 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034986] [ENSMUST00000121189]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034986
AA Change: T331A

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000034986
Gene: ENSMUSG00000032415
AA Change: T331A

DomainStartEndE-ValueType
Pfam:HECT_2 13 364 1e-104 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121189
SMART Domains Protein: ENSMUSP00000113549
Gene: ENSMUSG00000032415

DomainStartEndE-ValueType
Pfam:HECT_2 13 364 2.6e-80 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele cannot be obtained. Heterozygotes exhibit abnormal retinal pigment epithelium morphology and decreased a- and b-wave amplitude. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b C A 11: 109,977,813 G175V probably damaging Het
Agl T C 3: 116,781,054 I34V probably damaging Het
Cavin4 A T 4: 48,672,074 D173V probably damaging Het
Chd9 A G 8: 90,989,450 D884G probably damaging Het
Col6a5 G A 9: 105,928,120 R1196* probably null Het
Disc1 T C 8: 125,135,365 L492P probably damaging Het
Dscam A G 16: 96,649,991 probably null Het
Fbxw4 T C 19: 45,579,657 T26A probably benign Het
Hist1h1t A G 13: 23,696,202 K113E possibly damaging Het
Klhl24 T A 16: 20,120,121 Y475* probably null Het
Map4k3 C T 17: 80,593,283 probably null Het
Mfsd6 T C 1: 52,662,392 E633G probably damaging Het
Mycn G A 12: 12,939,793 R201* probably null Het
Nek11 T C 9: 105,314,745 I155M probably damaging Het
Notch2 G A 3: 98,072,862 V231I possibly damaging Het
Npnt A C 3: 132,906,775 V187G possibly damaging Het
Nr1d2 C A 14: 18,222,248 V8L possibly damaging Het
Nup188 C T 2: 30,339,847 T1359I probably damaging Het
Olfr1029 C A 2: 85,975,306 P21Q probably benign Het
Olfr1277 A T 2: 111,269,921 W149R probably damaging Het
Olfr164 T A 16: 19,286,432 I104L probably benign Het
Olfr957 T A 9: 39,511,058 I221F probably damaging Het
P2rx2 C T 5: 110,340,329 R453Q probably benign Het
Pcdhb7 A G 18: 37,342,024 E71G probably benign Het
Pcdhb9 A T 18: 37,401,958 D335V possibly damaging Het
Pcsk9 C T 4: 106,448,947 G368R probably damaging Het
Ptgr2 G A 12: 84,295,336 probably null Het
Rhebl1 T A 15: 98,878,270 I168F probably damaging Het
Serpina3b A G 12: 104,130,777 T106A probably benign Het
Sh3pxd2b A G 11: 32,422,422 I530V probably benign Het
Skint10 T C 4: 112,746,775 T72A probably benign Het
Slx4 G T 16: 4,001,284 F8L possibly damaging Het
Tdp2 T C 13: 24,831,853 L41P probably damaging Het
Tiam2 A G 17: 3,448,489 I847V probably benign Het
Tmem200c A G 17: 68,842,009 E529G probably benign Het
Tnpo1 T C 13: 98,856,908 D590G probably damaging Het
Ugt1a2 T A 1: 88,201,065 S143R probably damaging Het
Zfp58 A T 13: 67,491,293 C360S probably damaging Het
Other mutations in Ube2cbp
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0653:Ube2cbp UTSW 9 86451990 missense possibly damaging 0.95
R1163:Ube2cbp UTSW 9 86440595 missense probably benign 0.00
R1928:Ube2cbp UTSW 9 86423003 missense probably damaging 1.00
R1938:Ube2cbp UTSW 9 86448787 missense probably damaging 1.00
R2131:Ube2cbp UTSW 9 86372487 splice site probably null
R2760:Ube2cbp UTSW 9 86422974 missense probably benign 0.00
R4916:Ube2cbp UTSW 9 86422872 missense probably damaging 1.00
R5434:Ube2cbp UTSW 9 86427407 missense possibly damaging 0.95
R5804:Ube2cbp UTSW 9 86425348 missense probably benign 0.01
R5936:Ube2cbp UTSW 9 86372459 missense probably benign 0.00
R7275:Ube2cbp UTSW 9 86440626 missense probably damaging 1.00
X0019:Ube2cbp UTSW 9 86422888 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- GAAACTTGCTCGCCATGGAC -3'
(R):5'- TCTGCTTTATGCCAGCAACAG -3'

Sequencing Primer
(F):5'- GGACTCTCTCCTGTGAATGACAAG -3'
(R):5'- GAAGGTCACCAGACTCAGTTTTGTC -3'
Posted On2016-12-20