Incidental Mutation 'R5827:Ptgr2'
ID450223
Institutional Source Beutler Lab
Gene Symbol Ptgr2
Ensembl Gene ENSMUSG00000072946
Gene Nameprostaglandin reductase 2
SynonymsPGR-2, Zadh1, B830026H24Rik, 9630002F03Rik, 1810016I24Rik
MMRRC Submission 043218-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.176) question?
Stock #R5827 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location84285232-84315832 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 84295336 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000114766 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000123614] [ENSMUST00000123693] [ENSMUST00000135001] [ENSMUST00000135001] [ENSMUST00000146377] [ENSMUST00000146377] [ENSMUST00000147363] [ENSMUST00000147363]
Predicted Effect probably null
Transcript: ENSMUST00000123614
SMART Domains Protein: ENSMUSP00000115704
Gene: ENSMUSG00000072946

DomainStartEndE-ValueType
Pfam:ADH_N_2 4 165 5.4e-40 PFAM
Pfam:ADH_zinc_N 166 287 1.3e-15 PFAM
Pfam:ADH_zinc_N_2 200 343 4.5e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123693
SMART Domains Protein: ENSMUSP00000115506
Gene: ENSMUSG00000072946

DomainStartEndE-ValueType
Pfam:ADH_N_2 4 56 1.3e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128158
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128541
Predicted Effect probably null
Transcript: ENSMUST00000135001
SMART Domains Protein: ENSMUSP00000114559
Gene: ENSMUSG00000072946

DomainStartEndE-ValueType
Pfam:ADH_zinc_N 166 283 7.4e-19 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000135001
SMART Domains Protein: ENSMUSP00000114559
Gene: ENSMUSG00000072946

DomainStartEndE-ValueType
Pfam:ADH_zinc_N 166 283 7.4e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138733
Predicted Effect probably null
Transcript: ENSMUST00000146377
SMART Domains Protein: ENSMUSP00000119981
Gene: ENSMUSG00000072946

DomainStartEndE-ValueType
Pfam:ADH_zinc_N 166 283 1.4e-16 PFAM
Pfam:ADH_zinc_N_2 200 343 6.9e-9 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000146377
SMART Domains Protein: ENSMUSP00000119981
Gene: ENSMUSG00000072946

DomainStartEndE-ValueType
Pfam:ADH_zinc_N 166 283 1.4e-16 PFAM
Pfam:ADH_zinc_N_2 200 343 6.9e-9 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000147363
SMART Domains Protein: ENSMUSP00000114766
Gene: ENSMUSG00000072946

DomainStartEndE-ValueType
Pfam:ADH_zinc_N 166 283 1.2e-18 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000147363
SMART Domains Protein: ENSMUSP00000114766
Gene: ENSMUSG00000072946

DomainStartEndE-ValueType
Pfam:ADH_zinc_N 166 283 1.2e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150720
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme involved in the metabolism of prostaglandins. The encoded protein catalyzes the NADPH-dependent conversion of 15-keto-prostaglandin E2 to 15-keto-13,14-dihydro-prostaglandin E2. This protein may also be involved in regulating activation of the peroxisome proliferator-activated receptor. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2009]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b C A 11: 109,977,813 G175V probably damaging Het
Agl T C 3: 116,781,054 I34V probably damaging Het
Cavin4 A T 4: 48,672,074 D173V probably damaging Het
Chd9 A G 8: 90,989,450 D884G probably damaging Het
Col6a5 G A 9: 105,928,120 R1196* probably null Het
Disc1 T C 8: 125,135,365 L492P probably damaging Het
Dscam A G 16: 96,649,991 probably null Het
Fbxw4 T C 19: 45,579,657 T26A probably benign Het
Hist1h1t A G 13: 23,696,202 K113E possibly damaging Het
Klhl24 T A 16: 20,120,121 Y475* probably null Het
Map4k3 C T 17: 80,593,283 probably null Het
Mfsd6 T C 1: 52,662,392 E633G probably damaging Het
Mycn G A 12: 12,939,793 R201* probably null Het
Nek11 T C 9: 105,314,745 I155M probably damaging Het
Notch2 G A 3: 98,072,862 V231I possibly damaging Het
Npnt A C 3: 132,906,775 V187G possibly damaging Het
Nr1d2 C A 14: 18,222,248 V8L possibly damaging Het
Nup188 C T 2: 30,339,847 T1359I probably damaging Het
Olfr1029 C A 2: 85,975,306 P21Q probably benign Het
Olfr1277 A T 2: 111,269,921 W149R probably damaging Het
Olfr164 T A 16: 19,286,432 I104L probably benign Het
Olfr957 T A 9: 39,511,058 I221F probably damaging Het
P2rx2 C T 5: 110,340,329 R453Q probably benign Het
Pcdhb7 A G 18: 37,342,024 E71G probably benign Het
Pcdhb9 A T 18: 37,401,958 D335V possibly damaging Het
Pcsk9 C T 4: 106,448,947 G368R probably damaging Het
Rhebl1 T A 15: 98,878,270 I168F probably damaging Het
Serpina3b A G 12: 104,130,777 T106A probably benign Het
Sh3pxd2b A G 11: 32,422,422 I530V probably benign Het
Skint10 T C 4: 112,746,775 T72A probably benign Het
Slx4 G T 16: 4,001,284 F8L possibly damaging Het
Tdp2 T C 13: 24,831,853 L41P probably damaging Het
Tiam2 A G 17: 3,448,489 I847V probably benign Het
Tmem200c A G 17: 68,842,009 E529G probably benign Het
Tnpo1 T C 13: 98,856,908 D590G probably damaging Het
Ube2cbp T C 9: 86,372,436 T331A possibly damaging Het
Ugt1a2 T A 1: 88,201,065 S143R probably damaging Het
Zfp58 A T 13: 67,491,293 C360S probably damaging Het
Other mutations in Ptgr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02382:Ptgr2 APN 12 84313948 missense probably damaging 0.99
IGL03176:Ptgr2 APN 12 84307894 missense probably damaging 1.00
R1914:Ptgr2 UTSW 12 84302322 missense probably benign 0.11
R1915:Ptgr2 UTSW 12 84302322 missense probably benign 0.11
R4624:Ptgr2 UTSW 12 84308354 missense possibly damaging 0.70
R5978:Ptgr2 UTSW 12 84295258 nonsense probably null
R5986:Ptgr2 UTSW 12 84308346 missense possibly damaging 0.85
R6019:Ptgr2 UTSW 12 84298146 missense probably damaging 1.00
R6320:Ptgr2 UTSW 12 84302337 missense probably benign 0.05
R6526:Ptgr2 UTSW 12 84313952 missense probably damaging 1.00
R7369:Ptgr2 UTSW 12 84292306 start gained probably benign
R7401:Ptgr2 UTSW 12 84292329 start gained probably benign
R7463:Ptgr2 UTSW 12 84292298 start gained probably benign
Predicted Primers PCR Primer
(F):5'- TGGGGCCAAAATGCAACTTTC -3'
(R):5'- GTCACTTGGAAGAACTTCATTAACC -3'

Sequencing Primer
(F):5'- GGCCAAAATGCAACTTTCTAAATTTC -3'
(R):5'- TCCTGGAGCTATGTAGACCAG -3'
Posted On2016-12-20