Incidental Mutation 'R5827:Serpina3b'
ID450224
Institutional Source Beutler Lab
Gene Symbol Serpina3b
Ensembl Gene ENSMUSG00000066364
Gene Nameserine (or cysteine) peptidase inhibitor, clade A, member 3B
Synonymsantitrypsin, A030003A19Rik, alpha-1 antiproteinase, 6A1
MMRRC Submission 043218-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R5827 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location104127996-104139545 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 104130777 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 106 (T106A)
Ref Sequence ENSEMBL: ENSMUSP00000082127 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085052]
Predicted Effect probably benign
Transcript: ENSMUST00000085052
AA Change: T106A

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000082127
Gene: ENSMUSG00000066364
AA Change: T106A

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
SERPIN 56 417 1.1e-153 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b C A 11: 109,977,813 G175V probably damaging Het
Agl T C 3: 116,781,054 I34V probably damaging Het
Cavin4 A T 4: 48,672,074 D173V probably damaging Het
Chd9 A G 8: 90,989,450 D884G probably damaging Het
Col6a5 G A 9: 105,928,120 R1196* probably null Het
Disc1 T C 8: 125,135,365 L492P probably damaging Het
Dscam A G 16: 96,649,991 probably null Het
Fbxw4 T C 19: 45,579,657 T26A probably benign Het
Hist1h1t A G 13: 23,696,202 K113E possibly damaging Het
Klhl24 T A 16: 20,120,121 Y475* probably null Het
Map4k3 C T 17: 80,593,283 probably null Het
Mfsd6 T C 1: 52,662,392 E633G probably damaging Het
Mycn G A 12: 12,939,793 R201* probably null Het
Nek11 T C 9: 105,314,745 I155M probably damaging Het
Notch2 G A 3: 98,072,862 V231I possibly damaging Het
Npnt A C 3: 132,906,775 V187G possibly damaging Het
Nr1d2 C A 14: 18,222,248 V8L possibly damaging Het
Nup188 C T 2: 30,339,847 T1359I probably damaging Het
Olfr1029 C A 2: 85,975,306 P21Q probably benign Het
Olfr1277 A T 2: 111,269,921 W149R probably damaging Het
Olfr164 T A 16: 19,286,432 I104L probably benign Het
Olfr957 T A 9: 39,511,058 I221F probably damaging Het
P2rx2 C T 5: 110,340,329 R453Q probably benign Het
Pcdhb7 A G 18: 37,342,024 E71G probably benign Het
Pcdhb9 A T 18: 37,401,958 D335V possibly damaging Het
Pcsk9 C T 4: 106,448,947 G368R probably damaging Het
Ptgr2 G A 12: 84,295,336 probably null Het
Rhebl1 T A 15: 98,878,270 I168F probably damaging Het
Sh3pxd2b A G 11: 32,422,422 I530V probably benign Het
Skint10 T C 4: 112,746,775 T72A probably benign Het
Slx4 G T 16: 4,001,284 F8L possibly damaging Het
Tdp2 T C 13: 24,831,853 L41P probably damaging Het
Tiam2 A G 17: 3,448,489 I847V probably benign Het
Tmem200c A G 17: 68,842,009 E529G probably benign Het
Tnpo1 T C 13: 98,856,908 D590G probably damaging Het
Ube2cbp T C 9: 86,372,436 T331A possibly damaging Het
Ugt1a2 T A 1: 88,201,065 S143R probably damaging Het
Zfp58 A T 13: 67,491,293 C360S probably damaging Het
Other mutations in Serpina3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:Serpina3b APN 12 104138787 missense probably benign 0.03
IGL00427:Serpina3b APN 12 104132941 missense probably benign 0.06
IGL01637:Serpina3b APN 12 104132957 missense probably benign 0.00
IGL01738:Serpina3b APN 12 104130832 missense probably damaging 1.00
IGL02403:Serpina3b APN 12 104130462 start codon destroyed probably null 1.00
IGL03118:Serpina3b APN 12 104131054 missense probably benign 0.22
R0141:Serpina3b UTSW 12 104130771 missense probably damaging 1.00
R0217:Serpina3b UTSW 12 104130727 missense probably damaging 1.00
R0437:Serpina3b UTSW 12 104130670 missense probably damaging 1.00
R1295:Serpina3b UTSW 12 104130879 missense probably damaging 1.00
R1463:Serpina3b UTSW 12 104138710 missense probably benign 0.02
R1802:Serpina3b UTSW 12 104138637 missense probably damaging 1.00
R2104:Serpina3b UTSW 12 104138810 missense probably benign 0.01
R3871:Serpina3b UTSW 12 104138788 missense probably damaging 1.00
R4720:Serpina3b UTSW 12 104130630 missense possibly damaging 0.80
R5970:Serpina3b UTSW 12 104134091 missense possibly damaging 0.82
R6014:Serpina3b UTSW 12 104131097 missense possibly damaging 0.93
R6102:Serpina3b UTSW 12 104134169 missense probably benign 0.00
R6673:Serpina3b UTSW 12 104130669 missense probably damaging 0.96
R6807:Serpina3b UTSW 12 104132992 missense probably benign 0.00
R6836:Serpina3b UTSW 12 104134082 missense probably benign 0.30
R6893:Serpina3b UTSW 12 104133026 missense probably benign 0.04
R7414:Serpina3b UTSW 12 104132886 missense probably benign 0.03
R7539:Serpina3b UTSW 12 104130711 missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- CAATGCAGTCCAGAAAGGCC -3'
(R):5'- AGACCTCAGTGTGGTACAGAG -3'

Sequencing Primer
(F):5'- AGTTTAACACTGGCTTCCATCAAC -3'
(R):5'- CTCAGTGTGGTACAGAGCCCTTG -3'
Posted On2016-12-20