Incidental Mutation 'R5827:Zfp58'
ID450227
Institutional Source Beutler Lab
Gene Symbol Zfp58
Ensembl Gene ENSMUSG00000071291
Gene Namezinc finger protein 58
SynonymsZfp817, Mfg-1, A530094I17Rik, Mfg1
MMRRC Submission 043218-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.149) question?
Stock #R5827 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location67490167-67500555 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 67491293 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 360 (C360S)
Ref Sequence ENSEMBL: ENSMUSP00000132285 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076123] [ENSMUST00000091523] [ENSMUST00000163534] [ENSMUST00000167914] [ENSMUST00000171518]
Predicted Effect probably damaging
Transcript: ENSMUST00000076123
AA Change: C360S

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000075487
Gene: ENSMUSG00000071291
AA Change: C360S

DomainStartEndE-ValueType
KRAB 2 62 2.19e-29 SMART
ZnF_C2H2 106 128 4.01e-5 SMART
ZnF_C2H2 134 156 9.73e-4 SMART
ZnF_C2H2 162 184 5.67e-5 SMART
ZnF_C2H2 190 212 3.21e-4 SMART
ZnF_C2H2 218 240 2.57e-3 SMART
ZnF_C2H2 246 268 2.91e-2 SMART
ZnF_C2H2 274 296 9.73e-4 SMART
ZnF_C2H2 302 324 6.23e-2 SMART
ZnF_C2H2 330 352 1.03e-2 SMART
ZnF_C2H2 358 380 1.45e-2 SMART
ZnF_C2H2 386 408 2.99e-4 SMART
ZnF_C2H2 410 432 4.87e-4 SMART
ZnF_C2H2 438 460 2.75e-3 SMART
ZnF_C2H2 466 488 1.58e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000091523
SMART Domains Protein: ENSMUSP00000089108
Gene: ENSMUSG00000071291

DomainStartEndE-ValueType
KRAB 2 62 2.19e-29 SMART
ZnF_C2H2 106 128 4.01e-5 SMART
ZnF_C2H2 134 156 9.73e-4 SMART
ZnF_C2H2 162 184 5.67e-5 SMART
ZnF_C2H2 190 212 3.21e-4 SMART
ZnF_C2H2 218 240 2.57e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163534
SMART Domains Protein: ENSMUSP00000129177
Gene: ENSMUSG00000071291

DomainStartEndE-ValueType
KRAB 2 62 2.19e-29 SMART
ZnF_C2H2 106 128 4.01e-5 SMART
ZnF_C2H2 134 156 9.73e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167914
SMART Domains Protein: ENSMUSP00000137830
Gene: ENSMUSG00000097565

DomainStartEndE-ValueType
KRAB 5 65 4.41e-34 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000171518
AA Change: C360S

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000132285
Gene: ENSMUSG00000071291
AA Change: C360S

DomainStartEndE-ValueType
KRAB 2 62 2.19e-29 SMART
ZnF_C2H2 106 128 4.01e-5 SMART
ZnF_C2H2 134 156 9.73e-4 SMART
ZnF_C2H2 162 184 5.67e-5 SMART
ZnF_C2H2 190 212 3.21e-4 SMART
ZnF_C2H2 218 240 2.57e-3 SMART
ZnF_C2H2 246 268 2.91e-2 SMART
ZnF_C2H2 274 296 9.73e-4 SMART
ZnF_C2H2 302 324 6.23e-2 SMART
ZnF_C2H2 330 352 1.03e-2 SMART
ZnF_C2H2 358 380 1.45e-2 SMART
ZnF_C2H2 386 408 2.99e-4 SMART
ZnF_C2H2 410 432 4.87e-4 SMART
ZnF_C2H2 438 460 2.75e-3 SMART
ZnF_C2H2 466 488 1.58e-3 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b C A 11: 109,977,813 G175V probably damaging Het
Agl T C 3: 116,781,054 I34V probably damaging Het
Cavin4 A T 4: 48,672,074 D173V probably damaging Het
Chd9 A G 8: 90,989,450 D884G probably damaging Het
Col6a5 G A 9: 105,928,120 R1196* probably null Het
Disc1 T C 8: 125,135,365 L492P probably damaging Het
Dscam A G 16: 96,649,991 probably null Het
Fbxw4 T C 19: 45,579,657 T26A probably benign Het
Hist1h1t A G 13: 23,696,202 K113E possibly damaging Het
Klhl24 T A 16: 20,120,121 Y475* probably null Het
Map4k3 C T 17: 80,593,283 probably null Het
Mfsd6 T C 1: 52,662,392 E633G probably damaging Het
Mycn G A 12: 12,939,793 R201* probably null Het
Nek11 T C 9: 105,314,745 I155M probably damaging Het
Notch2 G A 3: 98,072,862 V231I possibly damaging Het
Npnt A C 3: 132,906,775 V187G possibly damaging Het
Nr1d2 C A 14: 18,222,248 V8L possibly damaging Het
Nup188 C T 2: 30,339,847 T1359I probably damaging Het
Olfr1029 C A 2: 85,975,306 P21Q probably benign Het
Olfr1277 A T 2: 111,269,921 W149R probably damaging Het
Olfr164 T A 16: 19,286,432 I104L probably benign Het
Olfr957 T A 9: 39,511,058 I221F probably damaging Het
P2rx2 C T 5: 110,340,329 R453Q probably benign Het
Pcdhb7 A G 18: 37,342,024 E71G probably benign Het
Pcdhb9 A T 18: 37,401,958 D335V possibly damaging Het
Pcsk9 C T 4: 106,448,947 G368R probably damaging Het
Ptgr2 G A 12: 84,295,336 probably null Het
Rhebl1 T A 15: 98,878,270 I168F probably damaging Het
Serpina3b A G 12: 104,130,777 T106A probably benign Het
Sh3pxd2b A G 11: 32,422,422 I530V probably benign Het
Skint10 T C 4: 112,746,775 T72A probably benign Het
Slx4 G T 16: 4,001,284 F8L possibly damaging Het
Tdp2 T C 13: 24,831,853 L41P probably damaging Het
Tiam2 A G 17: 3,448,489 I847V probably benign Het
Tmem200c A G 17: 68,842,009 E529G probably benign Het
Tnpo1 T C 13: 98,856,908 D590G probably damaging Het
Ube2cbp T C 9: 86,372,436 T331A possibly damaging Het
Ugt1a2 T A 1: 88,201,065 S143R probably damaging Het
Other mutations in Zfp58
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Zfp58 APN 13 67490995 missense probably benign 0.29
IGL02618:Zfp58 APN 13 67491356 missense possibly damaging 0.92
IGL03188:Zfp58 APN 13 67491409 missense probably benign 0.03
R0535:Zfp58 UTSW 13 67492082 nonsense probably null
R1470:Zfp58 UTSW 13 67492025 missense possibly damaging 0.71
R1470:Zfp58 UTSW 13 67492025 missense possibly damaging 0.71
R1750:Zfp58 UTSW 13 67491479 nonsense probably null
R1862:Zfp58 UTSW 13 67491188 missense probably damaging 1.00
R2697:Zfp58 UTSW 13 67491005 missense probably damaging 1.00
R3031:Zfp58 UTSW 13 67492112 missense probably benign 0.06
R3033:Zfp58 UTSW 13 67491622 missense probably damaging 1.00
R4200:Zfp58 UTSW 13 67491321 missense probably benign 0.25
R6723:Zfp58 UTSW 13 67494073 missense probably damaging 1.00
R7230:Zfp58 UTSW 13 67491963 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTCTTTTAAGGGATGAAGATCGGT -3'
(R):5'- CCTTCAGTACTCGCTCAACATATTAT -3'

Sequencing Primer
(F):5'- GGGTTTCTCTCCAGTATGAACAAGC -3'
(R):5'- CCCTACAAGTGTGCAGAATGTG -3'
Posted On2016-12-20