Incidental Mutation 'R5827:Pcdhb7'
ID450238
Institutional Source Beutler Lab
Gene Symbol Pcdhb7
Ensembl Gene ENSMUSG00000045062
Gene Nameprotocadherin beta 7
SynonymsPcdhb4B, PcdhbG
MMRRC Submission 043218-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R5827 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location37341702-37345202 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 37342024 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 71 (E71G)
Ref Sequence ENSEMBL: ENSMUSP00000051041 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053037] [ENSMUST00000061717] [ENSMUST00000115661] [ENSMUST00000194544]
Predicted Effect probably benign
Transcript: ENSMUST00000053037
AA Change: E71G

PolyPhen 2 Score 0.138 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000051041
Gene: ENSMUSG00000045062
AA Change: E71G

DomainStartEndE-ValueType
Pfam:Cadherin_2 61 143 1.4e-32 PFAM
CA 186 271 5.47e-17 SMART
CA 295 376 4.43e-26 SMART
CA 399 480 1.04e-22 SMART
CA 504 590 2.12e-23 SMART
CA 620 701 5.73e-11 SMART
Pfam:Cadherin_C_2 718 801 5.5e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000061717
SMART Domains Protein: ENSMUSP00000058592
Gene: ENSMUSG00000051678

DomainStartEndE-ValueType
Pfam:Cadherin_2 30 112 2.7e-33 PFAM
CA 155 240 1.48e-22 SMART
CA 264 344 3.02e-28 SMART
CA 367 448 1.69e-22 SMART
CA 472 558 1.65e-25 SMART
CA 588 669 6.24e-12 SMART
Pfam:Cadherin_C_2 685 768 4.7e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b C A 11: 109,977,813 G175V probably damaging Het
Agl T C 3: 116,781,054 I34V probably damaging Het
Cavin4 A T 4: 48,672,074 D173V probably damaging Het
Chd9 A G 8: 90,989,450 D884G probably damaging Het
Col6a5 G A 9: 105,928,120 R1196* probably null Het
Disc1 T C 8: 125,135,365 L492P probably damaging Het
Dscam A G 16: 96,649,991 probably null Het
Fbxw4 T C 19: 45,579,657 T26A probably benign Het
Hist1h1t A G 13: 23,696,202 K113E possibly damaging Het
Klhl24 T A 16: 20,120,121 Y475* probably null Het
Map4k3 C T 17: 80,593,283 probably null Het
Mfsd6 T C 1: 52,662,392 E633G probably damaging Het
Mycn G A 12: 12,939,793 R201* probably null Het
Nek11 T C 9: 105,314,745 I155M probably damaging Het
Notch2 G A 3: 98,072,862 V231I possibly damaging Het
Npnt A C 3: 132,906,775 V187G possibly damaging Het
Nr1d2 C A 14: 18,222,248 V8L possibly damaging Het
Nup188 C T 2: 30,339,847 T1359I probably damaging Het
Olfr1029 C A 2: 85,975,306 P21Q probably benign Het
Olfr1277 A T 2: 111,269,921 W149R probably damaging Het
Olfr164 T A 16: 19,286,432 I104L probably benign Het
Olfr957 T A 9: 39,511,058 I221F probably damaging Het
P2rx2 C T 5: 110,340,329 R453Q probably benign Het
Pcdhb9 A T 18: 37,401,958 D335V possibly damaging Het
Pcsk9 C T 4: 106,448,947 G368R probably damaging Het
Ptgr2 G A 12: 84,295,336 probably null Het
Rhebl1 T A 15: 98,878,270 I168F probably damaging Het
Serpina3b A G 12: 104,130,777 T106A probably benign Het
Sh3pxd2b A G 11: 32,422,422 I530V probably benign Het
Skint10 T C 4: 112,746,775 T72A probably benign Het
Slx4 G T 16: 4,001,284 F8L possibly damaging Het
Tdp2 T C 13: 24,831,853 L41P probably damaging Het
Tiam2 A G 17: 3,448,489 I847V probably benign Het
Tmem200c A G 17: 68,842,009 E529G probably benign Het
Tnpo1 T C 13: 98,856,908 D590G probably damaging Het
Ube2cbp T C 9: 86,372,436 T331A possibly damaging Het
Ugt1a2 T A 1: 88,201,065 S143R probably damaging Het
Zfp58 A T 13: 67,491,293 C360S probably damaging Het
Other mutations in Pcdhb7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01668:Pcdhb7 APN 18 37343152 missense probably benign 0.35
IGL01806:Pcdhb7 APN 18 37342495 missense possibly damaging 0.60
IGL01862:Pcdhb7 APN 18 37343862 missense possibly damaging 0.81
IGL01961:Pcdhb7 APN 18 37342473 missense probably damaging 1.00
R0184:Pcdhb7 UTSW 18 37343390 missense probably benign 0.44
R0426:Pcdhb7 UTSW 18 37342804 missense probably damaging 0.99
R0576:Pcdhb7 UTSW 18 37342357 missense probably benign 0.01
R0646:Pcdhb7 UTSW 18 37343389 missense probably damaging 1.00
R0656:Pcdhb7 UTSW 18 37341901 missense probably benign 0.01
R1216:Pcdhb7 UTSW 18 37343874 missense probably damaging 0.99
R1851:Pcdhb7 UTSW 18 37342578 missense possibly damaging 0.69
R2168:Pcdhb7 UTSW 18 37343282 missense probably benign 0.05
R2312:Pcdhb7 UTSW 18 37342197 missense probably benign
R3153:Pcdhb7 UTSW 18 37343073 missense probably damaging 1.00
R3758:Pcdhb7 UTSW 18 37343026 missense possibly damaging 0.84
R3763:Pcdhb7 UTSW 18 37341883 missense probably benign
R3940:Pcdhb7 UTSW 18 37343968 missense probably damaging 1.00
R3949:Pcdhb7 UTSW 18 37343088 missense probably benign 0.00
R4418:Pcdhb7 UTSW 18 37343482 missense probably benign 0.08
R4580:Pcdhb7 UTSW 18 37342135 missense probably damaging 1.00
R4880:Pcdhb7 UTSW 18 37342231 missense probably benign 0.00
R4936:Pcdhb7 UTSW 18 37342149 nonsense probably null
R4936:Pcdhb7 UTSW 18 37342150 missense probably damaging 1.00
R5086:Pcdhb7 UTSW 18 37343109 missense possibly damaging 0.56
R5517:Pcdhb7 UTSW 18 37341793 intron probably benign
R5570:Pcdhb7 UTSW 18 37344171 missense probably benign 0.35
R6187:Pcdhb7 UTSW 18 37342569 missense probably benign 0.23
R6194:Pcdhb7 UTSW 18 37342146 missense probably damaging 0.98
R6195:Pcdhb7 UTSW 18 37342656 missense probably benign 0.33
R6373:Pcdhb7 UTSW 18 37342211 nonsense probably null
R6398:Pcdhb7 UTSW 18 37343434 missense possibly damaging 0.86
R6437:Pcdhb7 UTSW 18 37342690 missense probably damaging 0.96
R6587:Pcdhb7 UTSW 18 37344103 missense probably benign
R6596:Pcdhb7 UTSW 18 37343361 missense probably damaging 0.97
R6646:Pcdhb7 UTSW 18 37343974 missense possibly damaging 0.90
R6702:Pcdhb7 UTSW 18 37341906 missense probably benign 0.03
R6923:Pcdhb7 UTSW 18 37342469 intron probably null
R6976:Pcdhb7 UTSW 18 37343578 missense probably benign 0.12
R7038:Pcdhb7 UTSW 18 37342204 missense possibly damaging 0.90
R7325:Pcdhb7 UTSW 18 37343387 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GAGTTCAGCATTTCAAAGCTTTGG -3'
(R):5'- TGGCTTTTCAAGAGTCACCTGG -3'

Sequencing Primer
(F):5'- GAAATTCTAAAGGATTGGTTGCAAGC -3'
(R):5'- GGCTTTTCAAGAGTCACCTGGAAATG -3'
Posted On2016-12-20