Mutagenetix > Incidental Mutation

Incidental Mutation 'R5827:Fbxw4'

450241

Institutional Source

Beutler Lab

Gene Symbol

Fbxw4

Ensembl Gene

ENSMUSG00000040913

Gene Name

F-box and WD-40 domain protein 4

Synonyms

dactylin, Fbw4, dactylyn

MMRRC Submission

043218-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.415) question?

Stock #

R5827 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

45566693-45648751 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 45568096 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 26 (T26A)

Ref Sequence

ENSEMBL: ENSMUSP00000124675 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000046869] [ENSMUST00000047057] [ENSMUST00000160003] [ENSMUST00000160018] [ENSMUST00000160438] [ENSMUST00000162433] [ENSMUST00000162879]

AlphaFold

Q9JMJ2

Predicted Effect

probably benign
Transcript: ENSMUST00000046869
AA Change: T323A

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000036505
Gene: ENSMUSG00000040913
AA Change: T323A

Domain	Start	End	E-Value	Type
low complexity region	2	22	N/A	INTRINSIC
FBOX	29	69	1.47e-2	SMART
WD40	150	187	3.45e-1	SMART
WD40	189	226	2.24e-2	SMART
WD40	232	274	8.91e-1	SMART
WD40	277	318	5.52e0	SMART
WD40	323	363	1.67e-1	SMART
Blast:WD40	366	406	1e-10	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000047057

SMART Domains

Protein: ENSMUSP00000045683
Gene: ENSMUSG00000041035

Domain	Start	End	E-Value	Type
Pfam:DPCD	6	195	4.5e-92	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000160003

SMART Domains

Protein: ENSMUSP00000124604
Gene: ENSMUSG00000040913

Domain	Start	End	E-Value	Type
Blast:WD40	1	36	2e-20	BLAST
SCOP:d1fwxa2	8	62	4e-7	SMART
Blast:WD40	39	79	1e-12	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000160018
AA Change: T26A

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000125641
Gene: ENSMUSG00000040913
AA Change: T26A

Domain	Start	End	E-Value	Type
Blast:WD40	1	21	8e-8	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000160438
AA Change: T98A

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000125136
Gene: ENSMUSG00000040913
AA Change: T98A

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
WD40	52	93	5.52e0	SMART
WD40	98	138	1.67e-1	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000160718

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161039

Predicted Effect

probably benign
Transcript: ENSMUST00000162433
AA Change: T26A

PolyPhen 2 Score 0.043 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000124998
Gene: ENSMUSG00000040913
AA Change: T26A

Domain	Start	End	E-Value	Type
Blast:WD40	1	21	5e-7	BLAST
WD40	26	66	1.67e-1	SMART
Blast:WD40	69	109	3e-12	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000162879
AA Change: T26A

PolyPhen 2 Score 0.045 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000124675
Gene: ENSMUSG00000040913
AA Change: T26A

Domain	Start	End	E-Value	Type
Blast:WD40	1	21	4e-7	BLAST
WD40	26	66	1.67e-1	SMART
Blast:WD40	69	102	8e-9	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161373

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.3%
20x: 95.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the F-box/WD-40 gene family, which recruit specific target proteins through their WD-40 protein-protein binding domains for ubiquitin mediated degradation. In mouse, a highly similar protein is thought to be responsible for maintaining the apical ectodermal ridge of developing limb buds; disruption of the mouse gene results in the absence of central digits, underdeveloped or absent metacarpal/metatarsal bones and syndactyly. This phenotype is remarkably similar to split hand-split foot malformation in humans, a clinically heterogeneous condition with a variety of modes of transmission. An autosomal recessive form has been mapped to the chromosomal region where this gene is located, and complex rearrangements involving duplications of this gene and others have been associated with the condition. A pseudogene of this locus has been mapped to one of the introns of the BCR gene on chromosome 22. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a spontaneous null mutation lack feet except for a single fused digit and die prenatally. Heterozygotes, in the presence of a recessive modifying allele, show loss of digits, frequently with fused metatarsal and metacarpal bones. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca8b	C	A	11: 109,868,639 (GRCm39)	G175V	probably damaging	Het
Agl	T	C	3: 116,574,703 (GRCm39)	I34V	probably damaging	Het
Cavin4	A	T	4: 48,672,074 (GRCm39)	D173V	probably damaging	Het
Chd9	A	G	8: 91,716,078 (GRCm39)	D884G	probably damaging	Het
Col6a5	G	A	9: 105,805,319 (GRCm39)	R1196*	probably null	Het
Disc1	T	C	8: 125,862,104 (GRCm39)	L492P	probably damaging	Het
Dscam	A	G	16: 96,451,191 (GRCm39)		probably null	Het
H1f6	A	G	13: 23,880,185 (GRCm39)	K113E	possibly damaging	Het
Klhl24	T	A	16: 19,938,871 (GRCm39)	Y475*	probably null	Het
Map4k3	C	T	17: 80,900,712 (GRCm39)		probably null	Het
Mfsd6	T	C	1: 52,701,551 (GRCm39)	E633G	probably damaging	Het
Mycn	G	A	12: 12,989,794 (GRCm39)	R201*	probably null	Het
Nek11	T	C	9: 105,191,944 (GRCm39)	I155M	probably damaging	Het
Notch2	G	A	3: 97,980,178 (GRCm39)	V231I	possibly damaging	Het
Npnt	A	C	3: 132,612,536 (GRCm39)	V187G	possibly damaging	Het
Nr1d2	C	A	14: 18,222,248 (GRCm38)	V8L	possibly damaging	Het
Nup188	C	T	2: 30,229,859 (GRCm39)	T1359I	probably damaging	Het
Or2m12	T	A	16: 19,105,182 (GRCm39)	I104L	probably benign	Het
Or4k35	A	T	2: 111,100,266 (GRCm39)	W149R	probably damaging	Het
Or5m11b	C	A	2: 85,805,650 (GRCm39)	P21Q	probably benign	Het
Or8g36	T	A	9: 39,422,354 (GRCm39)	I221F	probably damaging	Het
P2rx2	C	T	5: 110,488,195 (GRCm39)	R453Q	probably benign	Het
Pcdhb7	A	G	18: 37,475,077 (GRCm39)	E71G	probably benign	Het
Pcdhb9	A	T	18: 37,535,011 (GRCm39)	D335V	possibly damaging	Het
Pcsk9	C	T	4: 106,306,144 (GRCm39)	G368R	probably damaging	Het
Ptgr2	G	A	12: 84,342,110 (GRCm39)		probably null	Het
Rhebl1	T	A	15: 98,776,151 (GRCm39)	I168F	probably damaging	Het
Serpina3b	A	G	12: 104,097,036 (GRCm39)	T106A	probably benign	Het
Sh3pxd2b	A	G	11: 32,372,422 (GRCm39)	I530V	probably benign	Het
Skint10	T	C	4: 112,603,972 (GRCm39)	T72A	probably benign	Het
Slx4	G	T	16: 3,819,148 (GRCm39)	F8L	possibly damaging	Het
Tdp2	T	C	13: 25,015,836 (GRCm39)	L41P	probably damaging	Het
Tiam2	A	G	17: 3,498,764 (GRCm39)	I847V	probably benign	Het
Tmem200c	A	G	17: 69,149,004 (GRCm39)	E529G	probably benign	Het
Tnpo1	T	C	13: 98,993,416 (GRCm39)	D590G	probably damaging	Het
Ube3d	T	C	9: 86,254,489 (GRCm39)	T331A	possibly damaging	Het
Ugt1a2	T	A	1: 88,128,787 (GRCm39)	S143R	probably damaging	Het
Zfp58	A	T	13: 67,639,412 (GRCm39)	C360S	probably damaging	Het

Other mutations in Fbxw4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01120:Fbxw4	APN	19	45,628,955 (GRCm39)	missense	probably benign	0.09
IGL03089:Fbxw4	APN	19	45,580,160 (GRCm39)	splice site	probably benign
R4566:Fbxw4	UTSW	19	45,580,225 (GRCm39)	missense	probably benign	0.24
R6175:Fbxw4	UTSW	19	45,624,766 (GRCm39)	missense	probably benign	0.00
R6829:Fbxw4	UTSW	19	45,624,813 (GRCm39)	missense	possibly damaging	0.46
R6862:Fbxw4	UTSW	19	45,571,187 (GRCm39)	missense	probably benign	0.01
R7528:Fbxw4	UTSW	19	45,648,449 (GRCm39)	missense	unknown
R9015:Fbxw4	UTSW	19	45,624,874 (GRCm39)	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- AGGACCCATTGTAGAGGCTC -3'
(R):5'- GGCTTGCCATATCTTCCCTGAG -3'

Sequencing Primer
(F):5'- TGTAGAGGCTCTAAGAAATGTCTGC -3'
(R):5'- TCCTCTTCAGGAGCACCCAG -3'

Posted On

2016-12-20