Incidental Mutation 'R5828:Olfr360'
ID450246
Institutional Source Beutler Lab
Gene Symbol Olfr360
Ensembl Gene ENSMUSG00000083361
Gene Nameolfactory receptor 360
SynonymsMOR159-1, GA_x6K02T2NLDC-33760081-33761034
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R5828 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location37065746-37069651 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 37068989 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 228 (H228R)
Ref Sequence ENSEMBL: ENSMUSP00000149581 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120704] [ENSMUST00000216706]
Predicted Effect probably benign
Transcript: ENSMUST00000120505
AA Change: H228R

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000112456
Gene: ENSMUSG00000083361
AA Change: H228R

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 35 206 6e-7 PFAM
Pfam:7tm_1 41 289 1.1e-25 PFAM
Pfam:7tm_4 139 282 6.6e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120704
AA Change: H228R

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000114121
Gene: ENSMUSG00000083361
AA Change: H228R

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 2e-45 PFAM
Pfam:7TM_GPCR_Srsx 35 206 6e-7 PFAM
Pfam:7tm_1 41 289 5.6e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216706
AA Change: H228R

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Meta Mutation Damage Score 0.1248 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933409G03Rik A G 2: 68,601,800 D95G unknown Het
Arl10 T A 13: 54,578,955 V182E probably damaging Het
Cacna1g T G 11: 94,457,154 S703R probably damaging Het
Ces2a C A 8: 104,739,324 T363N probably benign Het
Col14a1 G A 15: 55,436,976 V967I unknown Het
Col22a1 A T 15: 72,009,491 F4I probably benign Het
D630045J12Rik A G 6: 38,196,367 W289R possibly damaging Het
Disc1 A G 8: 125,251,024 Q793R probably damaging Het
Dnhd1 C T 7: 105,720,181 T4337I probably benign Het
Eif2b5 T A 16: 20,502,786 V363D possibly damaging Het
Emsy T C 7: 98,593,492 T1147A probably benign Het
Epg5 T A 18: 78,020,851 Y2048N probably damaging Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Foxred1 A G 9: 35,210,196 probably benign Het
Gpaa1 T C 15: 76,332,271 probably benign Het
Gria4 A C 9: 4,432,832 L784V probably damaging Het
Homer3 A G 8: 70,286,306 Y105C probably benign Het
Hpgd T C 8: 56,319,071 S193P probably benign Het
Irf1 T A 11: 53,775,936 W247R probably benign Het
Lpgat1 A G 1: 191,776,382 Q344R possibly damaging Het
Luzp1 T C 4: 136,540,682 V72A probably damaging Het
Malrd1 G A 2: 15,526,653 V8M probably benign Het
Msmo1 T C 8: 64,719,110 H253R probably damaging Het
Nom1 A G 5: 29,435,126 K150R possibly damaging Het
Olfr310 T A 7: 86,269,520 M90L probably benign Het
Olfr483 T C 7: 108,103,798 V163A possibly damaging Het
Onecut1 A G 9: 74,862,760 E155G probably benign Het
Osbpl10 G A 9: 115,061,876 V111M probably damaging Het
Pcdhgb6 T C 18: 37,744,404 S722P probably benign Het
Plin4 T A 17: 56,107,064 D187V probably damaging Het
Pmf1 T C 3: 88,395,987 E89G possibly damaging Het
Polr1d A T 5: 147,077,598 probably benign Het
Ppp1r9a T C 6: 5,158,200 Y1006H probably damaging Het
Ppp2r5c A G 12: 110,570,700 K420E probably benign Het
Prdx1 T C 4: 116,693,809 L159P probably damaging Het
Psmd6 G T 14: 14,119,990 D39E probably benign Het
Rffl T C 11: 82,818,418 K60E probably damaging Het
Rspo2 A T 15: 43,075,887 L169Q probably damaging Het
Sbf1 T A 15: 89,288,634 D1892V probably damaging Het
Sbno2 G A 10: 80,066,590 S475F possibly damaging Het
Serpina3i T A 12: 104,265,215 V37E probably benign Het
Siglecf G A 7: 43,351,713 C35Y probably damaging Het
Slc22a27 G T 19: 7,926,402 D123E probably damaging Het
Smim23 T A 11: 32,820,592 K105* probably null Het
Soat1 C T 1: 156,437,748 S348N probably benign Het
Sp2 C T 11: 96,960,985 probably benign Het
St14 T A 9: 31,091,507 H700L probably damaging Het
St3gal1 T A 15: 67,113,785 K7* probably null Het
Tgm1 T C 14: 55,705,554 K610E probably benign Het
Tob1 T A 11: 94,213,757 Y40N probably damaging Het
Tob1 T A 11: 94,213,759 Y40* probably null Het
Trpc4ap A G 2: 155,635,210 probably benign Het
Ttc9 C T 12: 81,631,676 P91L probably benign Het
Zbtb18 T C 1: 177,447,880 S269P probably damaging Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Zfyve16 A T 13: 92,513,902 V858E probably damaging Het
Other mutations in Olfr360
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02394:Olfr360 APN 2 37068485 missense probably damaging 1.00
H8786:Olfr360 UTSW 2 37068329 missense probably benign 0.41
R4551:Olfr360 UTSW 2 37068343 missense probably benign 0.03
R4896:Olfr360 UTSW 2 37068410 missense probably damaging 1.00
R5004:Olfr360 UTSW 2 37068410 missense probably damaging 1.00
R6173:Olfr360 UTSW 2 37069079 missense possibly damaging 0.78
R6802:Olfr360 UTSW 2 37068415 missense probably benign
R6859:Olfr360 UTSW 2 37068782 missense probably damaging 0.98
R7171:Olfr360 UTSW 2 37068388 missense possibly damaging 0.91
T0722:Olfr360 UTSW 2 37068437 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAAGGTCACTCACTTCTTCTGTG -3'
(R):5'- AAAAGCCTCCATAGTGCTCC -3'

Sequencing Primer
(F):5'- GTGACATCACTCCTCTGCTGAAG -3'
(R):5'- AACATCTTGGTTCCTAAGGCTG -3'
Posted On2016-12-20