Incidental Mutation 'R5828:4933409G03Rik'
ID450247
Institutional Source Beutler Lab
Gene Symbol 4933409G03Rik
Ensembl Gene ENSMUSG00000053896
Gene NameRIKEN cDNA 4933409G03 gene
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R5828 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location68582413-68616463 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 68601800 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 95 (D95G)
Ref Sequence ENSEMBL: ENSMUSP00000099774 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102713]
Predicted Effect unknown
Transcript: ENSMUST00000102713
AA Change: D95G
SMART Domains Protein: ENSMUSP00000099774
Gene: ENSMUSG00000053896
AA Change: D95G

DomainStartEndE-ValueType
low complexity region 74 86 N/A INTRINSIC
low complexity region 89 133 N/A INTRINSIC
low complexity region 194 206 N/A INTRINSIC
low complexity region 220 231 N/A INTRINSIC
low complexity region 260 272 N/A INTRINSIC
low complexity region 293 305 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000137117
AA Change: D76G
SMART Domains Protein: ENSMUSP00000117165
Gene: ENSMUSG00000053896
AA Change: D76G

DomainStartEndE-ValueType
low complexity region 56 68 N/A INTRINSIC
low complexity region 71 115 N/A INTRINSIC
low complexity region 176 188 N/A INTRINSIC
Meta Mutation Damage Score 0.064 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 100% (63/63)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arl10 T A 13: 54,578,955 V182E probably damaging Het
Cacna1g T G 11: 94,457,154 S703R probably damaging Het
Ces2a C A 8: 104,739,324 T363N probably benign Het
Col14a1 G A 15: 55,436,976 V967I unknown Het
Col22a1 A T 15: 72,009,491 F4I probably benign Het
D630045J12Rik A G 6: 38,196,367 W289R possibly damaging Het
Disc1 A G 8: 125,251,024 Q793R probably damaging Het
Dnhd1 C T 7: 105,720,181 T4337I probably benign Het
Eif2b5 T A 16: 20,502,786 V363D possibly damaging Het
Emsy T C 7: 98,593,492 T1147A probably benign Het
Epg5 T A 18: 78,020,851 Y2048N probably damaging Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Foxred1 A G 9: 35,210,196 probably benign Het
Gpaa1 T C 15: 76,332,271 probably benign Het
Gria4 A C 9: 4,432,832 L784V probably damaging Het
Homer3 A G 8: 70,286,306 Y105C probably benign Het
Hpgd T C 8: 56,319,071 S193P probably benign Het
Irf1 T A 11: 53,775,936 W247R probably benign Het
Lpgat1 A G 1: 191,776,382 Q344R possibly damaging Het
Luzp1 T C 4: 136,540,682 V72A probably damaging Het
Malrd1 G A 2: 15,526,653 V8M probably benign Het
Msmo1 T C 8: 64,719,110 H253R probably damaging Het
Nom1 A G 5: 29,435,126 K150R possibly damaging Het
Olfr310 T A 7: 86,269,520 M90L probably benign Het
Olfr360 A G 2: 37,068,989 H228R probably benign Het
Olfr483 T C 7: 108,103,798 V163A possibly damaging Het
Onecut1 A G 9: 74,862,760 E155G probably benign Het
Osbpl10 G A 9: 115,061,876 V111M probably damaging Het
Pcdhgb6 T C 18: 37,744,404 S722P probably benign Het
Plin4 T A 17: 56,107,064 D187V probably damaging Het
Pmf1 T C 3: 88,395,987 E89G possibly damaging Het
Polr1d A T 5: 147,077,598 probably benign Het
Ppp1r9a T C 6: 5,158,200 Y1006H probably damaging Het
Ppp2r5c A G 12: 110,570,700 K420E probably benign Het
Prdx1 T C 4: 116,693,809 L159P probably damaging Het
Psmd6 G T 14: 14,119,990 D39E probably benign Het
Rffl T C 11: 82,818,418 K60E probably damaging Het
Rspo2 A T 15: 43,075,887 L169Q probably damaging Het
Sbf1 T A 15: 89,288,634 D1892V probably damaging Het
Sbno2 G A 10: 80,066,590 S475F possibly damaging Het
Serpina3i T A 12: 104,265,215 V37E probably benign Het
Siglecf G A 7: 43,351,713 C35Y probably damaging Het
Slc22a27 G T 19: 7,926,402 D123E probably damaging Het
Smim23 T A 11: 32,820,592 K105* probably null Het
Soat1 C T 1: 156,437,748 S348N probably benign Het
Sp2 C T 11: 96,960,985 probably benign Het
St14 T A 9: 31,091,507 H700L probably damaging Het
St3gal1 T A 15: 67,113,785 K7* probably null Het
Tgm1 T C 14: 55,705,554 K610E probably benign Het
Tob1 T A 11: 94,213,757 Y40N probably damaging Het
Tob1 T A 11: 94,213,759 Y40* probably null Het
Trpc4ap A G 2: 155,635,210 probably benign Het
Ttc9 C T 12: 81,631,676 P91L probably benign Het
Zbtb18 T C 1: 177,447,880 S269P probably damaging Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Zfyve16 A T 13: 92,513,902 V858E probably damaging Het
Other mutations in 4933409G03Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00498:4933409G03Rik APN 2 68601898 missense unknown
IGL00514:4933409G03Rik APN 2 68601797 missense unknown
IGL02173:4933409G03Rik APN 2 68613057 missense unknown
IGL02252:4933409G03Rik APN 2 68614334 splice site probably benign
PIT4812001:4933409G03Rik UTSW 2 68588948 missense probably benign 0.16
R0196:4933409G03Rik UTSW 2 68616247 unclassified probably benign
R1939:4933409G03Rik UTSW 2 68588984 missense possibly damaging 0.83
R2422:4933409G03Rik UTSW 2 68591520 missense probably benign 0.16
R3435:4933409G03Rik UTSW 2 68601845 missense unknown
R4124:4933409G03Rik UTSW 2 68616224 unclassified probably benign
R4243:4933409G03Rik UTSW 2 68593543 intron probably benign
R4424:4933409G03Rik UTSW 2 68615147 unclassified probably benign
R4649:4933409G03Rik UTSW 2 68606215 missense unknown
R4650:4933409G03Rik UTSW 2 68606215 missense unknown
R4651:4933409G03Rik UTSW 2 68606215 missense unknown
R4652:4933409G03Rik UTSW 2 68606215 missense unknown
R4653:4933409G03Rik UTSW 2 68606215 missense unknown
R4732:4933409G03Rik UTSW 2 68614721 unclassified probably benign
R4733:4933409G03Rik UTSW 2 68614721 unclassified probably benign
R5144:4933409G03Rik UTSW 2 68616260 unclassified probably benign
R5499:4933409G03Rik UTSW 2 68601793 missense unknown
R5936:4933409G03Rik UTSW 2 68615504 unclassified probably benign
R6323:4933409G03Rik UTSW 2 68606224 missense unknown
Predicted Primers PCR Primer
(F):5'- GGCTTAAGGTTACTGTGCATTCC -3'
(R):5'- TTTGGCTGGTGCTACACTAG -3'

Sequencing Primer
(F):5'- AAGGTTACTGTGCATTCCTTGGG -3'
(R):5'- TGGCTGGTGCTACACTAGTAAAC -3'
Posted On2016-12-20