Incidental Mutation 'R5828:Ppp1r9a'
ID450256
Institutional Source Beutler Lab
Gene Symbol Ppp1r9a
Ensembl Gene ENSMUSG00000032827
Gene Nameprotein phosphatase 1, regulatory (inhibitor) subunit 9A
SynonymsA230094E16Rik, Neurabin I, 2810430P21Rik, neurabin-I, NRB, 4930518N04Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.378) question?
Stock #R5828 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location4902917-5165661 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 5158200 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 1006 (Y1006H)
Ref Sequence ENSEMBL: ENSMUSP00000046906 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035813] [ENSMUST00000175889] [ENSMUST00000176263] [ENSMUST00000176729] [ENSMUST00000177153] [ENSMUST00000177456]
Predicted Effect probably damaging
Transcript: ENSMUST00000035813
AA Change: Y1006H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000046906
Gene: ENSMUSG00000032827
AA Change: Y1006H

DomainStartEndE-ValueType
low complexity region 416 435 N/A INTRINSIC
PDZ 513 593 4.26e-18 SMART
low complexity region 608 620 N/A INTRINSIC
Blast:PDZ 741 778 5e-15 BLAST
low complexity region 784 798 N/A INTRINSIC
SAM 986 1052 6.41e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164110
Predicted Effect possibly damaging
Transcript: ENSMUST00000175889
AA Change: Y1006H

PolyPhen 2 Score 0.770 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000135629
Gene: ENSMUSG00000032827
AA Change: Y1006H

DomainStartEndE-ValueType
low complexity region 416 435 N/A INTRINSIC
PDZ 513 593 4.26e-18 SMART
low complexity region 608 620 N/A INTRINSIC
Blast:PDZ 741 778 2e-15 BLAST
low complexity region 784 798 N/A INTRINSIC
SAM 986 1041 1.72e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176263
SMART Domains Protein: ENSMUSP00000134937
Gene: ENSMUSG00000032827

DomainStartEndE-ValueType
low complexity region 416 435 N/A INTRINSIC
PDZ 513 593 4.26e-18 SMART
low complexity region 608 620 N/A INTRINSIC
low complexity region 643 649 N/A INTRINSIC
Blast:PDZ 763 800 2e-15 BLAST
low complexity region 806 820 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176729
SMART Domains Protein: ENSMUSP00000134909
Gene: ENSMUSG00000032827

DomainStartEndE-ValueType
low complexity region 96 115 N/A INTRINSIC
PDB:3HVQ|D 116 232 4e-79 PDB
SCOP:d1be9a_ 174 232 5e-9 SMART
Blast:PDZ 193 232 1e-18 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000177153
SMART Domains Protein: ENSMUSP00000135485
Gene: ENSMUSG00000032827

DomainStartEndE-ValueType
low complexity region 416 435 N/A INTRINSIC
PDZ 513 593 4.26e-18 SMART
low complexity region 608 620 N/A INTRINSIC
Blast:PDZ 741 778 2e-15 BLAST
low complexity region 784 798 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177456
AA Change: Y1203H

PolyPhen 2 Score 0.221 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000134943
Gene: ENSMUSG00000032827
AA Change: Y1203H

DomainStartEndE-ValueType
low complexity region 416 435 N/A INTRINSIC
PDZ 513 593 4.26e-18 SMART
low complexity region 608 620 N/A INTRINSIC
Blast:PDZ 741 778 2e-15 BLAST
low complexity region 784 798 N/A INTRINSIC
low complexity region 966 987 N/A INTRINSIC
low complexity region 1040 1049 N/A INTRINSIC
low complexity region 1103 1114 N/A INTRINSIC
SAM 1183 1249 6.41e-16 SMART
Meta Mutation Damage Score 0.082 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is imprinted, and located in a cluster of imprinted genes on chromosome 7q12. This gene is transcribed in both neuronal and multiple embryonic tissues, and it is maternally expressed mainly in embryonic skeletal muscle tissues and biallelically expressed in other embryonic tissues. The protein encoded by this gene includes a PDZ domain and a sterile alpha motif (SAM). It is a regulatory subunit of protein phosphatase I, and controls actin cytoskeleton reorganization. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit defects in dopamine-mediated neuromodulation, deficient long-term potentiation at corticostriatal synapses, increased spontaneous excitatory post-synaptic current frequency, and enhanced locomotor activationin response to cocaine treatment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933409G03Rik A G 2: 68,601,800 D95G unknown Het
Arl10 T A 13: 54,578,955 V182E probably damaging Het
Cacna1g T G 11: 94,457,154 S703R probably damaging Het
Ces2a C A 8: 104,739,324 T363N probably benign Het
Col14a1 G A 15: 55,436,976 V967I unknown Het
Col22a1 A T 15: 72,009,491 F4I probably benign Het
D630045J12Rik A G 6: 38,196,367 W289R possibly damaging Het
Disc1 A G 8: 125,251,024 Q793R probably damaging Het
Dnhd1 C T 7: 105,720,181 T4337I probably benign Het
Eif2b5 T A 16: 20,502,786 V363D possibly damaging Het
Emsy T C 7: 98,593,492 T1147A probably benign Het
Epg5 T A 18: 78,020,851 Y2048N probably damaging Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Foxred1 A G 9: 35,210,196 probably benign Het
Gpaa1 T C 15: 76,332,271 probably benign Het
Gria4 A C 9: 4,432,832 L784V probably damaging Het
Homer3 A G 8: 70,286,306 Y105C probably benign Het
Hpgd T C 8: 56,319,071 S193P probably benign Het
Irf1 T A 11: 53,775,936 W247R probably benign Het
Lpgat1 A G 1: 191,776,382 Q344R possibly damaging Het
Luzp1 T C 4: 136,540,682 V72A probably damaging Het
Malrd1 G A 2: 15,526,653 V8M probably benign Het
Msmo1 T C 8: 64,719,110 H253R probably damaging Het
Nom1 A G 5: 29,435,126 K150R possibly damaging Het
Olfr310 T A 7: 86,269,520 M90L probably benign Het
Olfr360 A G 2: 37,068,989 H228R probably benign Het
Olfr483 T C 7: 108,103,798 V163A possibly damaging Het
Onecut1 A G 9: 74,862,760 E155G probably benign Het
Osbpl10 G A 9: 115,061,876 V111M probably damaging Het
Pcdhgb6 T C 18: 37,744,404 S722P probably benign Het
Plin4 T A 17: 56,107,064 D187V probably damaging Het
Pmf1 T C 3: 88,395,987 E89G possibly damaging Het
Polr1d A T 5: 147,077,598 probably benign Het
Ppp2r5c A G 12: 110,570,700 K420E probably benign Het
Prdx1 T C 4: 116,693,809 L159P probably damaging Het
Psmd6 G T 14: 14,119,990 D39E probably benign Het
Rffl T C 11: 82,818,418 K60E probably damaging Het
Rspo2 A T 15: 43,075,887 L169Q probably damaging Het
Sbf1 T A 15: 89,288,634 D1892V probably damaging Het
Sbno2 G A 10: 80,066,590 S475F possibly damaging Het
Serpina3i T A 12: 104,265,215 V37E probably benign Het
Siglecf G A 7: 43,351,713 C35Y probably damaging Het
Slc22a27 G T 19: 7,926,402 D123E probably damaging Het
Smim23 T A 11: 32,820,592 K105* probably null Het
Soat1 C T 1: 156,437,748 S348N probably benign Het
Sp2 C T 11: 96,960,985 probably benign Het
St14 T A 9: 31,091,507 H700L probably damaging Het
St3gal1 T A 15: 67,113,785 K7* probably null Het
Tgm1 T C 14: 55,705,554 K610E probably benign Het
Tob1 T A 11: 94,213,757 Y40N probably damaging Het
Tob1 T A 11: 94,213,759 Y40* probably null Het
Trpc4ap A G 2: 155,635,210 probably benign Het
Ttc9 C T 12: 81,631,676 P91L probably benign Het
Zbtb18 T C 1: 177,447,880 S269P probably damaging Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Zfyve16 A T 13: 92,513,902 V858E probably damaging Het
Other mutations in Ppp1r9a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00480:Ppp1r9a APN 6 5158195 missense possibly damaging 0.72
IGL00796:Ppp1r9a APN 6 5157014 missense probably benign 0.37
IGL00906:Ppp1r9a APN 6 5157023 missense possibly damaging 0.62
IGL01662:Ppp1r9a APN 6 5115322 missense probably damaging 1.00
IGL01695:Ppp1r9a APN 6 5064003 missense probably damaging 1.00
IGL01807:Ppp1r9a APN 6 5158248 nonsense probably null
IGL02126:Ppp1r9a APN 6 5156229 missense probably damaging 1.00
IGL02423:Ppp1r9a APN 6 4906537 missense probably benign 0.25
IGL03343:Ppp1r9a APN 6 5046015 missense probably damaging 1.00
IGL03365:Ppp1r9a APN 6 5110993 splice site probably benign
R0545:Ppp1r9a UTSW 6 5115357 missense probably benign 0.45
R1126:Ppp1r9a UTSW 6 4906795 missense possibly damaging 0.93
R1137:Ppp1r9a UTSW 6 5159697 missense possibly damaging 0.46
R1443:Ppp1r9a UTSW 6 5057557 missense probably damaging 1.00
R1484:Ppp1r9a UTSW 6 5113712 nonsense probably null
R1545:Ppp1r9a UTSW 6 5156242 critical splice donor site probably null
R1627:Ppp1r9a UTSW 6 4906168 missense possibly damaging 0.50
R1672:Ppp1r9a UTSW 6 5143491 critical splice donor site probably null
R1826:Ppp1r9a UTSW 6 5111060 splice site probably benign
R1834:Ppp1r9a UTSW 6 5113710 missense probably damaging 0.98
R1874:Ppp1r9a UTSW 6 4906348 missense possibly damaging 0.87
R2224:Ppp1r9a UTSW 6 5154074 missense probably benign
R2227:Ppp1r9a UTSW 6 5154074 missense probably benign
R2898:Ppp1r9a UTSW 6 4906558 missense probably benign 0.01
R3606:Ppp1r9a UTSW 6 5113674 missense possibly damaging 0.90
R3732:Ppp1r9a UTSW 6 4906259 unclassified probably benign
R3927:Ppp1r9a UTSW 6 5057531 missense probably damaging 1.00
R4631:Ppp1r9a UTSW 6 4906537 missense possibly damaging 0.62
R4682:Ppp1r9a UTSW 6 4905477 missense possibly damaging 0.48
R4766:Ppp1r9a UTSW 6 5157016 missense probably benign 0.11
R5197:Ppp1r9a UTSW 6 5156177 missense probably damaging 1.00
R5217:Ppp1r9a UTSW 6 5115367 missense probably damaging 1.00
R5493:Ppp1r9a UTSW 6 5159702 missense probably damaging 0.99
R5790:Ppp1r9a UTSW 6 5134363 intron probably benign
R5896:Ppp1r9a UTSW 6 5159648 missense probably damaging 1.00
R5930:Ppp1r9a UTSW 6 5157002 critical splice acceptor site probably null
R5990:Ppp1r9a UTSW 6 5134660 missense probably benign 0.05
R6017:Ppp1r9a UTSW 6 4906363 missense probably benign 0.18
R6122:Ppp1r9a UTSW 6 4905509 missense probably damaging 1.00
R6164:Ppp1r9a UTSW 6 5110715 intron probably benign
R6175:Ppp1r9a UTSW 6 4905639 nonsense probably null
R6188:Ppp1r9a UTSW 6 5158113 nonsense probably null
R6233:Ppp1r9a UTSW 6 5077610 missense probably damaging 1.00
R6321:Ppp1r9a UTSW 6 5115151 missense probably damaging 1.00
R6449:Ppp1r9a UTSW 6 5057458 missense probably benign 0.44
R6454:Ppp1r9a UTSW 6 4905827 missense probably damaging 1.00
R6527:Ppp1r9a UTSW 6 5045949 missense probably damaging 1.00
R7053:Ppp1r9a UTSW 6 4905670 missense probably damaging 1.00
R7233:Ppp1r9a UTSW 6 5134804 missense probably benign
R7238:Ppp1r9a UTSW 6 5159716 missense probably damaging 1.00
R7438:Ppp1r9a UTSW 6 5115378 missense probably damaging 0.99
R7497:Ppp1r9a UTSW 6 4905775 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATTTCCATCTACCAGAATCAGATAGG -3'
(R):5'- AGTACTGACGAAAACTACCACATGG -3'

Sequencing Primer
(F):5'- GTAAATGCAGCTCTTGTAACTTGAG -3'
(R):5'- TGGATGTGCAGATCAACCATGTC -3'
Posted On2016-12-20