Incidental Mutation 'R5828:Sp2'
ID450283
Institutional Source Beutler Lab
Gene Symbol Sp2
Ensembl Gene ENSMUSG00000018678
Gene NameSp2 transcription factor
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5828 (G1)
Quality Score218
Status Validated
Chromosome11
Chromosomal Location96953341-96982959 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) C to T at 96960985 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000103250 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062652] [ENSMUST00000107623] [ENSMUST00000107624]
Predicted Effect probably benign
Transcript: ENSMUST00000062652
SMART Domains Protein: ENSMUSP00000051403
Gene: ENSMUSG00000018678

DomainStartEndE-ValueType
low complexity region 42 59 N/A INTRINSIC
low complexity region 203 216 N/A INTRINSIC
low complexity region 281 313 N/A INTRINSIC
low complexity region 365 375 N/A INTRINSIC
low complexity region 420 431 N/A INTRINSIC
ZnF_C2H2 519 543 5.14e-3 SMART
ZnF_C2H2 549 573 8.47e-4 SMART
ZnF_C2H2 579 601 3.58e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107623
SMART Domains Protein: ENSMUSP00000103249
Gene: ENSMUSG00000018678

DomainStartEndE-ValueType
low complexity region 42 59 N/A INTRINSIC
low complexity region 203 216 N/A INTRINSIC
low complexity region 281 313 N/A INTRINSIC
low complexity region 365 375 N/A INTRINSIC
low complexity region 420 431 N/A INTRINSIC
ZnF_C2H2 519 543 5.14e-3 SMART
ZnF_C2H2 549 573 8.47e-4 SMART
ZnF_C2H2 579 601 3.58e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107624
SMART Domains Protein: ENSMUSP00000103250
Gene: ENSMUSG00000018678

DomainStartEndE-ValueType
low complexity region 42 59 N/A INTRINSIC
low complexity region 203 216 N/A INTRINSIC
low complexity region 281 313 N/A INTRINSIC
low complexity region 365 375 N/A INTRINSIC
low complexity region 420 431 N/A INTRINSIC
ZnF_C2H2 519 543 5.14e-3 SMART
ZnF_C2H2 549 573 8.47e-4 SMART
ZnF_C2H2 579 601 3.58e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000107628
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135825
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186326
Meta Mutation Damage Score 0.044 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: This gene encodes a member of the Sp subfamily of Sp/XKLF transcription factors. Sp family proteins are sequence-specific DNA-binding proteins characterized by an amino-terminal trans-activation domain and three carboxy-terminal zinc finger motifs. This protein contains the least conserved DNA-binding domain within the Sp subfamily of proteins, and its DNA sequence specificity differs from the other Sp proteins. The protein can act as a transcriptional activator or repressor, depending on the promoter and cell type. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: No homozygous null mice survived beyond E10.5, with decrease embryo size and embryonic growth retardation starting at E7.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933409G03Rik A G 2: 68,601,800 D95G unknown Het
Arl10 T A 13: 54,578,955 V182E probably damaging Het
Cacna1g T G 11: 94,457,154 S703R probably damaging Het
Ces2a C A 8: 104,739,324 T363N probably benign Het
Col14a1 G A 15: 55,436,976 V967I unknown Het
Col22a1 A T 15: 72,009,491 F4I probably benign Het
D630045J12Rik A G 6: 38,196,367 W289R possibly damaging Het
Disc1 A G 8: 125,251,024 Q793R probably damaging Het
Dnhd1 C T 7: 105,720,181 T4337I probably benign Het
Eif2b5 T A 16: 20,502,786 V363D possibly damaging Het
Emsy T C 7: 98,593,492 T1147A probably benign Het
Epg5 T A 18: 78,020,851 Y2048N probably damaging Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Foxred1 A G 9: 35,210,196 probably benign Het
Gpaa1 T C 15: 76,332,271 probably benign Het
Gria4 A C 9: 4,432,832 L784V probably damaging Het
Homer3 A G 8: 70,286,306 Y105C probably benign Het
Hpgd T C 8: 56,319,071 S193P probably benign Het
Irf1 T A 11: 53,775,936 W247R probably benign Het
Lpgat1 A G 1: 191,776,382 Q344R possibly damaging Het
Luzp1 T C 4: 136,540,682 V72A probably damaging Het
Malrd1 G A 2: 15,526,653 V8M probably benign Het
Msmo1 T C 8: 64,719,110 H253R probably damaging Het
Nom1 A G 5: 29,435,126 K150R possibly damaging Het
Olfr310 T A 7: 86,269,520 M90L probably benign Het
Olfr360 A G 2: 37,068,989 H228R probably benign Het
Olfr483 T C 7: 108,103,798 V163A possibly damaging Het
Onecut1 A G 9: 74,862,760 E155G probably benign Het
Osbpl10 G A 9: 115,061,876 V111M probably damaging Het
Pcdhgb6 T C 18: 37,744,404 S722P probably benign Het
Plin4 T A 17: 56,107,064 D187V probably damaging Het
Pmf1 T C 3: 88,395,987 E89G possibly damaging Het
Polr1d A T 5: 147,077,598 probably benign Het
Ppp1r9a T C 6: 5,158,200 Y1006H probably damaging Het
Ppp2r5c A G 12: 110,570,700 K420E probably benign Het
Prdx1 T C 4: 116,693,809 L159P probably damaging Het
Psmd6 G T 14: 14,119,990 D39E probably benign Het
Rffl T C 11: 82,818,418 K60E probably damaging Het
Rspo2 A T 15: 43,075,887 L169Q probably damaging Het
Sbf1 T A 15: 89,288,634 D1892V probably damaging Het
Sbno2 G A 10: 80,066,590 S475F possibly damaging Het
Serpina3i T A 12: 104,265,215 V37E probably benign Het
Siglecf G A 7: 43,351,713 C35Y probably damaging Het
Slc22a27 G T 19: 7,926,402 D123E probably damaging Het
Smim23 T A 11: 32,820,592 K105* probably null Het
Soat1 C T 1: 156,437,748 S348N probably benign Het
St14 T A 9: 31,091,507 H700L probably damaging Het
St3gal1 T A 15: 67,113,785 K7* probably null Het
Tgm1 T C 14: 55,705,554 K610E probably benign Het
Tob1 T A 11: 94,213,757 Y40N probably damaging Het
Tob1 T A 11: 94,213,759 Y40* probably null Het
Trpc4ap A G 2: 155,635,210 probably benign Het
Ttc9 C T 12: 81,631,676 P91L probably benign Het
Zbtb18 T C 1: 177,447,880 S269P probably damaging Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Zfyve16 A T 13: 92,513,902 V858E probably damaging Het
Other mutations in Sp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:Sp2 APN 11 96954561 missense probably damaging 1.00
IGL00228:Sp2 APN 11 96954561 missense probably damaging 1.00
IGL00467:Sp2 APN 11 96954561 missense probably damaging 1.00
IGL00470:Sp2 APN 11 96954561 missense probably damaging 1.00
IGL00476:Sp2 APN 11 96954561 missense probably damaging 1.00
IGL00505:Sp2 APN 11 96954561 missense probably damaging 1.00
IGL00535:Sp2 APN 11 96954561 missense probably damaging 1.00
IGL01865:Sp2 APN 11 96961042 missense probably damaging 1.00
IGL02170:Sp2 APN 11 96956210 missense probably damaging 0.99
IGL03342:Sp2 APN 11 96961762 missense probably damaging 0.99
PIT4696001:Sp2 UTSW 11 96961973 missense probably damaging 1.00
R0082:Sp2 UTSW 11 96961699 missense probably damaging 1.00
R0086:Sp2 UTSW 11 96957427 missense probably damaging 1.00
R0525:Sp2 UTSW 11 96956098 critical splice donor site probably benign
R0789:Sp2 UTSW 11 96961376 missense probably benign 0.18
R1463:Sp2 UTSW 11 96963456 critical splice acceptor site probably benign
R1941:Sp2 UTSW 11 96955936 missense probably damaging 1.00
R2049:Sp2 UTSW 11 96961365 missense probably benign 0.09
R2153:Sp2 UTSW 11 96962008 missense possibly damaging 0.92
R2230:Sp2 UTSW 11 96955936 missense probably damaging 1.00
R2232:Sp2 UTSW 11 96955936 missense probably damaging 1.00
R2237:Sp2 UTSW 11 96955936 missense probably damaging 1.00
R2238:Sp2 UTSW 11 96955936 missense probably damaging 1.00
R2247:Sp2 UTSW 11 96962018 splice site probably null
R4638:Sp2 UTSW 11 96957474 missense possibly damaging 0.89
R5016:Sp2 UTSW 11 96955832 missense probably damaging 0.96
R5099:Sp2 UTSW 11 96961349 missense probably damaging 0.99
R5125:Sp2 UTSW 11 96955838 missense probably benign 0.00
R5178:Sp2 UTSW 11 96955838 missense probably benign 0.00
R6286:Sp2 UTSW 11 96961546 missense probably benign 0.01
R6997:Sp2 UTSW 11 96957726 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- GTATACAGATCTACCCCATTATGCCC -3'
(R):5'- AACCTGCTGATCGTCCAGAG -3'

Sequencing Primer
(F):5'- TTATGCCCCCAGAGCTACC -3'
(R):5'- TGTGGTCCAGCAAGTCCAG -3'
Posted On2016-12-20