Incidental Mutation 'R5828:Zfyve16'
ID450288
Institutional Source Beutler Lab
Gene Symbol Zfyve16
Ensembl Gene ENSMUSG00000021706
Gene Namezinc finger, FYVE domain containing 16
SynonymsB130024H06Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.155) question?
Stock #R5828 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location92487108-92530868 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 92513902 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 858 (V858E)
Ref Sequence ENSEMBL: ENSMUSP00000022217 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022217]
Predicted Effect probably damaging
Transcript: ENSMUST00000022217
AA Change: V858E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022217
Gene: ENSMUSG00000021706
AA Change: V858E

DomainStartEndE-ValueType
low complexity region 163 175 N/A INTRINSIC
low complexity region 367 381 N/A INTRINSIC
low complexity region 438 449 N/A INTRINSIC
low complexity region 455 484 N/A INTRINSIC
low complexity region 569 580 N/A INTRINSIC
FYVE 727 794 7.25e-31 SMART
low complexity region 821 838 N/A INTRINSIC
low complexity region 1002 1014 N/A INTRINSIC
low complexity region 1050 1063 N/A INTRINSIC
Pfam:DUF3480 1155 1503 3.3e-169 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136135
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154850
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156586
Meta Mutation Damage Score 0.374 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an endosomal protein that belongs to the FYVE zinc finger family of proteins. The encoded protein is thought to regulate membrane trafficking in the endosome. This protein functions as a scaffold protein in the transforming growth factor-beta signaling pathway and is involved in positive and negative feedback regulation of the bone morphogenetic protein signaling pathway. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933409G03Rik A G 2: 68,601,800 D95G unknown Het
Arl10 T A 13: 54,578,955 V182E probably damaging Het
Cacna1g T G 11: 94,457,154 S703R probably damaging Het
Ces2a C A 8: 104,739,324 T363N probably benign Het
Col14a1 G A 15: 55,436,976 V967I unknown Het
Col22a1 A T 15: 72,009,491 F4I probably benign Het
D630045J12Rik A G 6: 38,196,367 W289R possibly damaging Het
Disc1 A G 8: 125,251,024 Q793R probably damaging Het
Dnhd1 C T 7: 105,720,181 T4337I probably benign Het
Eif2b5 T A 16: 20,502,786 V363D possibly damaging Het
Emsy T C 7: 98,593,492 T1147A probably benign Het
Epg5 T A 18: 78,020,851 Y2048N probably damaging Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Foxred1 A G 9: 35,210,196 probably benign Het
Gpaa1 T C 15: 76,332,271 probably benign Het
Gria4 A C 9: 4,432,832 L784V probably damaging Het
Homer3 A G 8: 70,286,306 Y105C probably benign Het
Hpgd T C 8: 56,319,071 S193P probably benign Het
Irf1 T A 11: 53,775,936 W247R probably benign Het
Lpgat1 A G 1: 191,776,382 Q344R possibly damaging Het
Luzp1 T C 4: 136,540,682 V72A probably damaging Het
Malrd1 G A 2: 15,526,653 V8M probably benign Het
Msmo1 T C 8: 64,719,110 H253R probably damaging Het
Nom1 A G 5: 29,435,126 K150R possibly damaging Het
Olfr310 T A 7: 86,269,520 M90L probably benign Het
Olfr360 A G 2: 37,068,989 H228R probably benign Het
Olfr483 T C 7: 108,103,798 V163A possibly damaging Het
Onecut1 A G 9: 74,862,760 E155G probably benign Het
Osbpl10 G A 9: 115,061,876 V111M probably damaging Het
Pcdhgb6 T C 18: 37,744,404 S722P probably benign Het
Plin4 T A 17: 56,107,064 D187V probably damaging Het
Pmf1 T C 3: 88,395,987 E89G possibly damaging Het
Polr1d A T 5: 147,077,598 probably benign Het
Ppp1r9a T C 6: 5,158,200 Y1006H probably damaging Het
Ppp2r5c A G 12: 110,570,700 K420E probably benign Het
Prdx1 T C 4: 116,693,809 L159P probably damaging Het
Psmd6 G T 14: 14,119,990 D39E probably benign Het
Rffl T C 11: 82,818,418 K60E probably damaging Het
Rspo2 A T 15: 43,075,887 L169Q probably damaging Het
Sbf1 T A 15: 89,288,634 D1892V probably damaging Het
Sbno2 G A 10: 80,066,590 S475F possibly damaging Het
Serpina3i T A 12: 104,265,215 V37E probably benign Het
Siglecf G A 7: 43,351,713 C35Y probably damaging Het
Slc22a27 G T 19: 7,926,402 D123E probably damaging Het
Smim23 T A 11: 32,820,592 K105* probably null Het
Soat1 C T 1: 156,437,748 S348N probably benign Het
Sp2 C T 11: 96,960,985 probably benign Het
St14 T A 9: 31,091,507 H700L probably damaging Het
St3gal1 T A 15: 67,113,785 K7* probably null Het
Tgm1 T C 14: 55,705,554 K610E probably benign Het
Tob1 T A 11: 94,213,757 Y40N probably damaging Het
Tob1 T A 11: 94,213,759 Y40* probably null Het
Trpc4ap A G 2: 155,635,210 probably benign Het
Ttc9 C T 12: 81,631,676 P91L probably benign Het
Zbtb18 T C 1: 177,447,880 S269P probably damaging Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Other mutations in Zfyve16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Zfyve16 APN 13 92516538 missense possibly damaging 0.56
IGL00737:Zfyve16 APN 13 92521118 nonsense probably null
IGL00741:Zfyve16 APN 13 92524253 missense probably damaging 1.00
IGL00753:Zfyve16 APN 13 92521118 nonsense probably null
IGL01123:Zfyve16 APN 13 92492522 missense probably damaging 1.00
IGL01149:Zfyve16 APN 13 92508283 missense probably damaging 1.00
IGL01414:Zfyve16 APN 13 92522196 missense probably benign 0.04
IGL01771:Zfyve16 APN 13 92522172 missense probably benign 0.38
IGL01889:Zfyve16 APN 13 92522569 missense possibly damaging 0.87
IGL01928:Zfyve16 APN 13 92504498 missense probably damaging 0.97
IGL02524:Zfyve16 APN 13 92504514 missense probably benign 0.19
IGL03102:Zfyve16 APN 13 92511817 missense possibly damaging 0.57
IGL03192:Zfyve16 APN 13 92521240 missense possibly damaging 0.94
PIT4151001:Zfyve16 UTSW 13 92521204 missense probably damaging 0.99
R0321:Zfyve16 UTSW 13 92492534 missense probably damaging 0.99
R0548:Zfyve16 UTSW 13 92494944 missense probably benign 0.00
R0555:Zfyve16 UTSW 13 92516520 splice site probably benign
R0616:Zfyve16 UTSW 13 92521129 missense probably damaging 1.00
R0727:Zfyve16 UTSW 13 92493878 missense possibly damaging 0.81
R0730:Zfyve16 UTSW 13 92521477 missense probably damaging 0.98
R1221:Zfyve16 UTSW 13 92508305 missense possibly damaging 0.87
R1297:Zfyve16 UTSW 13 92522332 missense probably benign 0.41
R1597:Zfyve16 UTSW 13 92508247 missense probably benign 0.02
R1635:Zfyve16 UTSW 13 92509020 missense probably damaging 1.00
R1803:Zfyve16 UTSW 13 92504085 missense probably damaging 1.00
R1840:Zfyve16 UTSW 13 92511525 missense possibly damaging 0.79
R1962:Zfyve16 UTSW 13 92522744 missense possibly damaging 0.74
R2029:Zfyve16 UTSW 13 92504477 missense probably damaging 0.98
R2083:Zfyve16 UTSW 13 92524262 missense probably damaging 1.00
R2122:Zfyve16 UTSW 13 92519483 nonsense probably null
R2173:Zfyve16 UTSW 13 92495088 missense probably damaging 0.99
R3822:Zfyve16 UTSW 13 92521261 missense probably damaging 1.00
R3857:Zfyve16 UTSW 13 92494971 missense probably damaging 1.00
R4043:Zfyve16 UTSW 13 92513763 intron probably null
R4056:Zfyve16 UTSW 13 92504549 missense probably damaging 1.00
R4495:Zfyve16 UTSW 13 92488567 missense probably benign 0.25
R4518:Zfyve16 UTSW 13 92521312 missense possibly damaging 0.86
R4835:Zfyve16 UTSW 13 92522185 missense probably benign 0.18
R4862:Zfyve16 UTSW 13 92508256 missense probably damaging 1.00
R4962:Zfyve16 UTSW 13 92513894 missense probably damaging 1.00
R5117:Zfyve16 UTSW 13 92505689 missense possibly damaging 0.95
R5344:Zfyve16 UTSW 13 92521588 missense possibly damaging 0.79
R5358:Zfyve16 UTSW 13 92508263 missense probably benign 0.04
R5407:Zfyve16 UTSW 13 92500284 missense probably damaging 1.00
R5410:Zfyve16 UTSW 13 92521231 missense probably benign 0.08
R5704:Zfyve16 UTSW 13 92504471 splice site probably null
R5731:Zfyve16 UTSW 13 92508193 missense probably benign 0.11
R5808:Zfyve16 UTSW 13 92495055 nonsense probably null
R5928:Zfyve16 UTSW 13 92522117 missense probably benign 0.01
R6044:Zfyve16 UTSW 13 92522666 nonsense probably null
R6141:Zfyve16 UTSW 13 92511597 missense probably benign 0.00
R6538:Zfyve16 UTSW 13 92504516 missense probably damaging 1.00
R6594:Zfyve16 UTSW 13 92513818 missense probably benign 0.23
R6767:Zfyve16 UTSW 13 92508199 missense probably damaging 1.00
R6942:Zfyve16 UTSW 13 92516631 missense probably benign
R7011:Zfyve16 UTSW 13 92521987 missense probably benign 0.00
R7381:Zfyve16 UTSW 13 92521146 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCATCCAAAGGATAAGCACACTAG -3'
(R):5'- TCCCTAGGCATGGACTCTTC -3'

Sequencing Primer
(F):5'- GATAAGCACACTAGTAATCACGTG -3'
(R):5'- CTAGGCATGGACTCTTCTCAGG -3'
Posted On2016-12-20