Incidental Mutation 'R5840:Abca2'
ID450353
Institutional Source Beutler Lab
Gene Symbol Abca2
Ensembl Gene ENSMUSG00000026944
Gene NameATP-binding cassette, sub-family A (ABC1), member 2
SynonymsAbc2, D2H0S1474E
MMRRC Submission 044060-MU
Accession Numbers

NCBI RefSeq: NM_007379.2; MGI: 99606

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5840 (G1)
Quality Score203
Status Validated
Chromosome2
Chromosomal Location25428703-25448540 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 25433359 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 113 (R113Q)
Ref Sequence ENSEMBL: ENSMUSP00000099983 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102919]
Predicted Effect probably benign
Transcript: ENSMUST00000102919
AA Change: R113Q

PolyPhen 2 Score 0.342 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000099983
Gene: ENSMUSG00000026944
AA Change: R113Q

DomainStartEndE-ValueType
transmembrane domain 21 40 N/A INTRINSIC
low complexity region 119 130 N/A INTRINSIC
low complexity region 220 237 N/A INTRINSIC
coiled coil region 271 296 N/A INTRINSIC
low complexity region 309 346 N/A INTRINSIC
Pfam:ABC2_membrane_3 493 911 9.7e-18 PFAM
AAA 1015 1197 9.22e-7 SMART
low complexity region 1364 1376 N/A INTRINSIC
low complexity region 1589 1607 N/A INTRINSIC
Pfam:ABC2_membrane_3 1696 2008 2.3e-44 PFAM
AAA 2079 2264 1.12e-5 SMART
low complexity region 2375 2394 N/A INTRINSIC
Meta Mutation Damage Score 0.228 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.3%
  • 10x: 96.5%
  • 20x: 88.1%
Validation Efficiency 99% (75/76)
MGI Phenotype Strain: 3697467; 3719855
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. This protein is highly expressed in brain tissue and may play a role in macrophage lipid metabolism and neural development. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Null mice show tremors, hyperactivity, abnormal coordination, and alterations in CNS myelin sheath ultrastructure, [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(4)

Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aip G A 19: 4,116,010 P147L possibly damaging Het
Anapc1 A C 2: 128,607,037 probably benign Het
Arhgap42 C T 9: 9,046,517 V240I possibly damaging Het
Axdnd1 T C 1: 156,348,958 E684G probably damaging Het
BC005624 G A 2: 30,981,857 R2W probably benign Het
Cd177 T G 7: 24,758,070 Q182P probably damaging Het
Cdca5 G A 19: 6,090,369 E187K possibly damaging Het
Chmp1a T C 8: 123,208,100 Q39R probably benign Het
Dab2ip A G 2: 35,727,499 I1079V probably damaging Het
Dip2c A T 13: 9,506,676 E85D possibly damaging Het
Elmo2 A T 2: 165,295,552 S497R possibly damaging Het
Ephb6 C T 6: 41,615,573 A339V possibly damaging Het
Foxred1 T C 9: 35,210,139 K38E probably damaging Het
Frem2 T A 3: 53,647,921 T1732S probably damaging Het
Fto A G 8: 91,666,440 probably benign Het
Gm17430 T A 18: 9,726,528 Q48L probably damaging Het
Gng2 A G 14: 19,875,814 I70T probably damaging Het
Gtf2a2 A G 9: 70,015,293 probably benign Het
Invs A G 4: 48,396,284 D263G probably damaging Het
Itga2b C T 11: 102,461,331 V475M probably damaging Het
Kansl1l A G 1: 66,770,215 probably benign Het
Klhl25 T C 7: 75,866,692 F449L possibly damaging Het
Lamb1 T A 12: 31,266,756 C83S probably damaging Het
Loxl4 G T 19: 42,598,715 T648K probably damaging Het
Lrit2 T C 14: 37,069,005 F214L possibly damaging Het
N4bp2 T G 5: 65,808,094 L1162R probably damaging Het
Naa40 A T 19: 7,230,008 I117N probably benign Het
Ncapd3 T C 9: 27,094,758 S1492P probably benign Het
Nf2 T A 11: 4,816,146 D128V probably benign Het
Nox4 T C 7: 87,360,793 S401P probably benign Het
Nt5c1b T C 12: 10,377,171 V323A probably damaging Het
Olfr1474 G A 19: 13,471,878 V303I probably benign Het
Olfr601 T A 7: 103,358,369 H275L probably damaging Het
Olfr622 C T 7: 103,639,256 V295I probably benign Het
Pcdhb14 T C 18: 37,448,750 V303A probably benign Het
Pde8a C A 7: 81,213,965 H17Q probably benign Het
Pfkl C T 10: 77,988,724 V716I probably benign Het
Phc3 G A 3: 30,936,583 S495L possibly damaging Het
Psg18 A G 7: 18,346,602 probably benign Het
Rcc2 T G 4: 140,712,138 N175K possibly damaging Het
Rhot2 G A 17: 25,840,058 T276I probably benign Het
Rnase9 A T 14: 51,038,988 Y178N probably benign Het
Sema4b T C 7: 80,218,949 C297R probably damaging Het
Slc35d2 T C 13: 64,118,413 probably null Het
Sptlc3 A T 2: 139,547,206 N169Y probably damaging Het
Srsf9 T G 5: 115,331,465 M29R probably benign Het
Stip1 C A 19: 7,022,068 D449Y possibly damaging Het
Syne2 T A 12: 75,880,291 probably null Het
Tgm5 A G 2: 121,085,660 probably null Het
Thbs2 A T 17: 14,681,430 probably null Het
Trak2 T C 1: 58,919,273 E283G probably damaging Het
Trbv21 A G 6: 41,202,858 Y36C probably damaging Het
Trpm7 A T 2: 126,822,611 Y949* probably null Het
Ubqln5 T C 7: 104,128,954 D221G possibly damaging Het
Ubxn4 T A 1: 128,259,525 V85D possibly damaging Het
Vmn1r172 T A 7: 23,660,175 W162R probably benign Het
Vrk2 A G 11: 26,534,314 probably benign Het
Zc3h8 A C 2: 128,929,904 D276E probably benign Het
Zfp369 C T 13: 65,297,278 T745I possibly damaging Het
Zfp608 T C 18: 54,898,906 K654R probably damaging Het
Other mutations in Abca2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Abca2 APN 2 25445963 splice site probably null
IGL01102:Abca2 APN 2 25433956 splice site probably benign
IGL01322:Abca2 APN 2 25446782 splice site probably null
IGL01402:Abca2 APN 2 25442003 missense probably damaging 1.00
IGL01419:Abca2 APN 2 25437514 missense probably damaging 1.00
IGL01490:Abca2 APN 2 25446011 missense probably damaging 1.00
IGL01633:Abca2 APN 2 25444394 missense possibly damaging 0.66
IGL01661:Abca2 APN 2 25442995 missense probably benign 0.01
IGL01804:Abca2 APN 2 25446625 missense probably damaging 1.00
IGL01933:Abca2 APN 2 25444111 missense probably damaging 1.00
IGL01941:Abca2 APN 2 25443095 missense probably benign 0.02
IGL02158:Abca2 APN 2 25447879 utr 3 prime probably benign
IGL02173:Abca2 APN 2 25441897 missense probably benign 0.00
IGL02419:Abca2 APN 2 25446837 missense probably benign
IGL02532:Abca2 APN 2 25435136 missense probably benign 0.03
IGL02572:Abca2 APN 2 25433317 missense possibly damaging 0.95
Abseiling UTSW 2 25447003 missense possibly damaging 0.65
R0126:Abca2 UTSW 2 25443730 missense possibly damaging 0.88
R0140:Abca2 UTSW 2 25438085 critical splice donor site probably null
R0372:Abca2 UTSW 2 25437353 missense probably damaging 1.00
R0437:Abca2 UTSW 2 25442845 missense probably damaging 0.99
R0505:Abca2 UTSW 2 25434894 missense probably benign 0.22
R0570:Abca2 UTSW 2 25447405 splice site probably null
R1037:Abca2 UTSW 2 25438228 splice site probably benign
R1283:Abca2 UTSW 2 25446689 missense probably damaging 1.00
R1448:Abca2 UTSW 2 25440530 missense possibly damaging 0.73
R1464:Abca2 UTSW 2 25447834 splice site probably benign
R1468:Abca2 UTSW 2 25441296 missense probably damaging 0.99
R1468:Abca2 UTSW 2 25441296 missense probably damaging 0.99
R1480:Abca2 UTSW 2 25433397 missense possibly damaging 0.60
R1545:Abca2 UTSW 2 25442358 missense probably benign 0.17
R1562:Abca2 UTSW 2 25446319 missense probably benign 0.43
R1569:Abca2 UTSW 2 25439185 missense probably benign 0.45
R1586:Abca2 UTSW 2 25447216 missense probably damaging 0.98
R1635:Abca2 UTSW 2 25444856 missense probably benign 0.03
R1699:Abca2 UTSW 2 25447351 missense possibly damaging 0.80
R1754:Abca2 UTSW 2 25434333 missense probably benign 0.01
R1760:Abca2 UTSW 2 25443043 missense probably benign 0.00
R2040:Abca2 UTSW 2 25443805 missense probably damaging 1.00
R2067:Abca2 UTSW 2 25437505 missense possibly damaging 0.88
R2111:Abca2 UTSW 2 25437505 missense possibly damaging 0.88
R2248:Abca2 UTSW 2 25433464 splice site probably benign
R2323:Abca2 UTSW 2 25445175 missense probably benign 0.00
R2418:Abca2 UTSW 2 25437989 missense probably benign 0.22
R2419:Abca2 UTSW 2 25437989 missense probably benign 0.22
R3816:Abca2 UTSW 2 25446071 missense probably damaging 1.00
R4180:Abca2 UTSW 2 25441578 missense possibly damaging 0.58
R4431:Abca2 UTSW 2 25442852 missense probably benign
R4468:Abca2 UTSW 2 25444902 missense probably damaging 1.00
R4704:Abca2 UTSW 2 25443412 missense probably damaging 0.99
R4839:Abca2 UTSW 2 25440909 missense probably damaging 0.99
R4933:Abca2 UTSW 2 25444827 missense probably benign 0.25
R4970:Abca2 UTSW 2 25438371 missense probably damaging 1.00
R4971:Abca2 UTSW 2 25441994 missense probably damaging 0.97
R5112:Abca2 UTSW 2 25438371 missense probably damaging 1.00
R5327:Abca2 UTSW 2 25445674 missense probably damaging 1.00
R5378:Abca2 UTSW 2 25446068 missense probably damaging 1.00
R5648:Abca2 UTSW 2 25436498 critical splice donor site probably null
R5725:Abca2 UTSW 2 25439400 missense probably damaging 0.98
R5825:Abca2 UTSW 2 25436736 missense probably benign 0.36
R5837:Abca2 UTSW 2 25433359 missense probably benign 0.34
R5851:Abca2 UTSW 2 25442310 missense possibly damaging 0.58
R6262:Abca2 UTSW 2 25444910 missense possibly damaging 0.56
R6344:Abca2 UTSW 2 25437694 missense probably damaging 1.00
R6547:Abca2 UTSW 2 25433338 missense possibly damaging 0.80
R6640:Abca2 UTSW 2 25447003 missense possibly damaging 0.65
R6980:Abca2 UTSW 2 25440866 missense possibly damaging 0.89
R6981:Abca2 UTSW 2 25444139 missense probably damaging 1.00
R7070:Abca2 UTSW 2 25442995 missense probably benign 0.06
R7080:Abca2 UTSW 2 25446104 missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- AGTTTGGCTTCCTGCAATATGC -3'
(R):5'- CTCAAGCACACAGGTAAGGGAC -3'

Sequencing Primer
(F):5'- TGCAATATGCCAACTCCACGTG -3'
(R):5'- CACAAGGTCCCAGAGTGATG -3'
Posted On2016-12-20