Incidental Mutation 'R5841:Olfr585'
ID450438
Institutional Source Beutler Lab
Gene Symbol Olfr585
Ensembl Gene ENSMUSG00000078080
Gene Nameolfactory receptor 585
SynonymsMOR14-4, GA_x6K02T2PBJ9-5809085-5810035
MMRRC Submission 044061-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R5841 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location103097720-103098749 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 103097954 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 71 (F71S)
Ref Sequence ENSEMBL: ENSMUSP00000100476 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000104881]
Predicted Effect probably damaging
Transcript: ENSMUST00000104881
AA Change: F71S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000100476
Gene: ENSMUSG00000078080
AA Change: F71S

DomainStartEndE-ValueType
Pfam:7tm_4 40 318 1.3e-109 PFAM
Pfam:7TM_GPCR_Srsx 45 315 5.9e-6 PFAM
Pfam:7tm_1 50 300 7.9e-23 PFAM
Meta Mutation Damage Score 0.448 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb6 A T 1: 75,174,350 F565L possibly damaging Het
Abhd6 T A 14: 8,049,596 V188D probably benign Het
Bbs12 T G 3: 37,319,521 N39K probably benign Het
Bend5 A G 4: 111,433,470 Y221C probably damaging Het
Brd8 A G 18: 34,605,523 S683P probably damaging Het
Caskin1 A G 17: 24,496,209 D79G probably damaging Het
Cdyl T C 13: 35,872,561 L509P probably damaging Het
Cenpf G T 1: 189,657,444 T1397N possibly damaging Het
Ckap5 T A 2: 91,600,682 M1479K probably benign Het
Cpsf2 T C 12: 101,985,238 S145P probably damaging Het
Cyp4a12a A T 4: 115,326,702 H235L probably benign Het
Cyp7b1 A T 3: 18,097,506 F181Y probably damaging Het
Dennd5b T C 6: 149,044,755 T453A probably benign Het
Dlgap3 A G 4: 127,195,400 D263G probably damaging Het
Dnah3 TTCCTC TTC 7: 119,951,021 probably benign Het
Dync2li1 G A 17: 84,633,562 G69R probably damaging Het
Edc3 T C 9: 57,744,602 V331A probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Ganc C T 2: 120,411,539 T66I possibly damaging Het
Gm11595 C A 11: 99,772,317 C179F unknown Het
Gm13088 A G 4: 143,655,539 S196P possibly damaging Het
Gm15448 T A 7: 3,822,899 R324* probably null Het
Gnptg A G 17: 25,235,417 S159P probably damaging Het
Gsdmc2 C T 15: 63,826,210 V349I probably benign Het
Hydin T C 8: 110,533,214 I2606T possibly damaging Het
Ino80d A G 1: 63,058,840 S632P probably damaging Het
Kcnn2 G A 18: 45,559,396 R13H probably benign Het
Klb A T 5: 65,379,324 K666* probably null Het
Kmt2d G A 15: 98,852,109 probably benign Het
Kpna7 T C 5: 144,993,956 I360V possibly damaging Het
Lmbrd2 A G 15: 9,182,570 K576E possibly damaging Het
Lrp2 T A 2: 69,480,153 Y2692F probably benign Het
Meis2 T A 2: 116,058,664 E202D probably benign Het
Mgat4c A T 10: 102,388,965 T347S probably damaging Het
Mmp12 G A 9: 7,347,501 C26Y possibly damaging Het
Mrpl24 G A 3: 87,922,985 R145Q probably damaging Het
Mtpn C T 6: 35,512,290 D100N probably benign Het
Mycbpap T A 11: 94,505,610 R135W probably damaging Het
Myo1g T A 11: 6,507,000 Y942F probably benign Het
Myrf T C 19: 10,223,547 K52R probably null Het
Ncf2 A T 1: 152,821,518 silent Het
Otx1 T C 11: 21,998,594 probably benign Het
Pcnx T A 12: 81,918,655 V532D possibly damaging Het
Pik3r5 T C 11: 68,492,270 L305P probably damaging Het
Polr3a A T 14: 24,450,698 C1341S probably benign Het
Ppp1r3a T C 6: 14,718,984 T644A probably benign Het
Ptbp1 A G 10: 79,859,932 D289G probably benign Het
Pwp2 A G 10: 78,172,118 F868L probably benign Het
Rgs8 A G 1: 153,692,828 E153G probably damaging Het
Rhbdf2 G A 11: 116,602,354 probably benign Het
Sbf1 T C 15: 89,308,068 H78R probably damaging Het
Sdr16c6 C T 4: 4,062,728 A197T possibly damaging Het
Slc36a3 A T 11: 55,125,721 Y349* probably null Het
Slc38a9 T C 13: 112,695,322 L202P possibly damaging Het
Slc40a1 A T 1: 45,912,349 M216K probably damaging Het
Slc9a3r2 A T 17: 24,644,877 M8K probably benign Het
Srebf1 T A 11: 60,203,584 Q568H possibly damaging Het
Srp54b A G 12: 55,252,829 N315S probably benign Het
Strc A G 2: 121,365,877 F1557L probably benign Het
Susd3 C A 13: 49,238,726 probably benign Het
Usp54 G A 14: 20,550,283 T1462I probably benign Het
Vmn1r11 T A 6: 57,137,802 N150K probably damaging Het
Vwa8 C T 14: 78,994,518 H606Y probably benign Het
Zmym6 A G 4: 127,100,670 I206V possibly damaging Het
Other mutations in Olfr585
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01022:Olfr585 APN 7 103097870 missense probably damaging 1.00
IGL02866:Olfr585 APN 7 103098383 missense probably damaging 0.99
FR4548:Olfr585 UTSW 7 103098309 nonsense probably null
FR4976:Olfr585 UTSW 7 103098309 small insertion probably benign
R0893:Olfr585 UTSW 7 103098434 missense probably benign 0.01
R0926:Olfr585 UTSW 7 103097885 missense probably damaging 1.00
R1486:Olfr585 UTSW 7 103098430 missense probably damaging 1.00
R2031:Olfr585 UTSW 7 103098164 missense probably damaging 0.98
R3852:Olfr585 UTSW 7 103098184 missense probably damaging 0.97
R4849:Olfr585 UTSW 7 103098319 missense possibly damaging 0.95
R5241:Olfr585 UTSW 7 103098317 missense probably benign 0.36
R5668:Olfr585 UTSW 7 103097896 missense probably benign 0.42
R6902:Olfr585 UTSW 7 103098355 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- GCAAATGCTACAAATGCAGGAC -3'
(R):5'- GTTTGCAGATCGCTACATAACG -3'

Sequencing Primer
(F):5'- GAATTCCTAAGCAACTTCACATCG -3'
(R):5'- GCAGATCGCTACATAACGATCAAAAG -3'
Posted On2016-12-20