Incidental Mutation 'R0549:Tcp10a'
ID45045
Institutional Source Beutler Lab
Gene Symbol Tcp10a
Ensembl Gene ENSMUSG00000071322
Gene Namet-complex protein 10a
SynonymsD17Leh66A, D17Leh66aa, T66A-a, Gm10326, Tcp-10a
MMRRC Submission 038741-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.041) question?
Stock #R0549 (G1)
Quality Score223
Status Validated
Chromosome17
Chromosomal Location7324646-7345974 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 7326551 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 92 (K92E)
Ref Sequence ENSEMBL: ENSMUSP00000114830 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095726] [ENSMUST00000128533] [ENSMUST00000129709] [ENSMUST00000138222] [ENSMUST00000140192] [ENSMUST00000144861] [ENSMUST00000147803]
Predicted Effect probably benign
Transcript: ENSMUST00000095726
AA Change: K92E

PolyPhen 2 Score 0.112 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000093394
Gene: ENSMUSG00000071322
AA Change: K92E

DomainStartEndE-ValueType
coiled coil region 57 94 N/A INTRINSIC
low complexity region 241 256 N/A INTRINSIC
Pfam:Tcp10_C 263 437 1.3e-83 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128533
AA Change: K92E

PolyPhen 2 Score 0.112 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000114351
Gene: ENSMUSG00000071322
AA Change: K92E

DomainStartEndE-ValueType
coiled coil region 57 94 N/A INTRINSIC
low complexity region 241 256 N/A INTRINSIC
Pfam:Tcp10_C 261 438 1.1e-90 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129709
AA Change: K92E

PolyPhen 2 Score 0.112 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000114830
Gene: ENSMUSG00000071322
AA Change: K92E

DomainStartEndE-ValueType
coiled coil region 57 94 N/A INTRINSIC
low complexity region 241 256 N/A INTRINSIC
Pfam:Tcp10_C 261 438 1.1e-90 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138222
AA Change: K74E

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000115431
Gene: ENSMUSG00000071322
AA Change: K74E

DomainStartEndE-ValueType
coiled coil region 36 76 N/A INTRINSIC
low complexity region 223 238 N/A INTRINSIC
Pfam:Tcp10_C 245 419 6.7e-84 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140192
AA Change: K92E

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000117557
Gene: ENSMUSG00000071322
AA Change: K92E

DomainStartEndE-ValueType
coiled coil region 57 94 N/A INTRINSIC
low complexity region 241 256 N/A INTRINSIC
Pfam:Tcp10_C 261 401 3.5e-68 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144861
AA Change: K92E

PolyPhen 2 Score 0.102 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000122766
Gene: ENSMUSG00000071322
AA Change: K92E

DomainStartEndE-ValueType
coiled coil region 57 94 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147803
Meta Mutation Damage Score 0.456 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 96% (48/50)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 A G 17: 46,322,290 F498L probably damaging Het
Adamts6 A T 13: 104,297,255 D64V possibly damaging Het
Agbl2 T C 2: 90,789,843 probably benign Het
Angptl3 A G 4: 99,031,455 S151G probably benign Het
Arhgap39 C T 15: 76,734,886 D833N probably damaging Het
C4b G T 17: 34,735,415 L927I probably damaging Het
Ccl3 T C 11: 83,648,336 T66A probably damaging Het
Cdh7 T C 1: 110,108,944 L618P probably damaging Het
Cfap65 T C 1: 74,918,444 T989A probably benign Het
Cnpy4 T C 5: 138,187,637 F18S possibly damaging Het
Col6a5 A G 9: 105,904,579 probably benign Het
Dppa2 G A 16: 48,318,671 R289H probably benign Het
Evx2 T C 2: 74,659,134 T96A probably benign Het
Frmd4a A G 2: 4,603,967 E577G possibly damaging Het
Gcgr G A 11: 120,536,561 G166S probably benign Het
Gm4788 A T 1: 139,739,488 D377E probably damaging Het
Gm5316 T C 6: 122,900,191 noncoding transcript Het
Gria1 G A 11: 57,228,973 R292Q probably damaging Het
Hars2 T A 18: 36,786,208 probably null Het
Hkdc1 T A 10: 62,400,240 T508S probably benign Het
Kif2b A T 11: 91,576,584 I291N probably damaging Het
Lmbrd1 A T 1: 24,744,920 T377S probably benign Het
Lrrc28 A G 7: 67,628,342 probably benign Het
Mmp3 A T 9: 7,455,638 N463I probably benign Het
Myh6 A G 14: 54,958,608 F578S probably damaging Het
Ncbp1 T A 4: 46,168,476 M608K possibly damaging Het
Nf1 T C 11: 79,468,771 F1412L probably damaging Het
Nlrp5 T A 7: 23,441,802 W1083R probably damaging Het
Nrsn1 T C 13: 25,262,258 Y45C probably benign Het
Olfr401 T G 11: 74,121,475 M62R probably damaging Het
Osbpl7 G T 11: 97,067,542 R881L probably damaging Het
Papss1 A G 3: 131,619,213 E456G possibly damaging Het
Pbxip1 T A 3: 89,443,592 probably benign Het
Pcca A G 14: 122,638,377 probably benign Het
Pde1a T A 2: 79,865,070 N511I probably damaging Het
Prpf39 A T 12: 65,056,256 I435F probably benign Het
Rnf213 C T 11: 119,465,082 T4117M probably damaging Het
Sel1l2 A T 2: 140,265,882 M216K probably damaging Het
Sidt2 A G 9: 45,953,119 probably null Het
Sirt3 A T 7: 140,869,487 probably null Het
Smpd4 T C 16: 17,639,312 V378A probably benign Het
Svil T A 18: 5,064,566 S642T possibly damaging Het
Tmem144 T C 3: 79,822,744 D233G probably damaging Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Tnik T C 3: 28,570,920 S335P possibly damaging Het
Ush2a T C 1: 188,946,953 L4786P probably damaging Het
Utp11 A T 4: 124,686,079 probably benign Het
Vmn1r67 A G 7: 10,447,714 N241D probably damaging Het
Vmn2r11 A T 5: 109,052,097 C497S possibly damaging Het
Other mutations in Tcp10a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01538:Tcp10a APN 17 7343500 missense probably damaging 1.00
IGL01868:Tcp10a APN 17 7329864 missense possibly damaging 0.79
IGL02942:Tcp10a APN 17 7329919 missense probably damaging 0.99
IGL03293:Tcp10a APN 17 7326492 missense possibly damaging 0.62
R0032:Tcp10a UTSW 17 7336907 missense probably benign 0.02
R0129:Tcp10a UTSW 17 7343504 missense probably damaging 1.00
R0271:Tcp10a UTSW 17 7331156 missense probably benign 0.06
R0352:Tcp10a UTSW 17 7326406 missense probably damaging 0.98
R1445:Tcp10a UTSW 17 7326007 critical splice donor site probably null
R2147:Tcp10a UTSW 17 7334302 missense probably damaging 0.98
R2937:Tcp10a UTSW 17 7329774 missense probably damaging 1.00
R4599:Tcp10a UTSW 17 7336924 missense probably damaging 0.99
R4601:Tcp10a UTSW 17 7325975 missense probably benign 0.01
R5982:Tcp10a UTSW 17 7345026 missense possibly damaging 0.61
R7132:Tcp10a UTSW 17 7344952 missense not run
Z1088:Tcp10a UTSW 17 7326449 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCTGGTAAGTGTCTGTCACTCTC -3'
(R):5'- TTCCATCAGAGCCTGTGAGTGTCC -3'

Sequencing Primer
(F):5'- TCTTCCTACCCCAGGGGC -3'
(R):5'- AGCCTGTGAGTGTCCTAGAGAC -3'
Posted On2013-06-11