Incidental Mutation 'R5842:Atp12a'
ID450509
Institutional Source Beutler Lab
Gene Symbol Atp12a
Ensembl Gene ENSMUSG00000022229
Gene NameATPase, H+/K+ transporting, nongastric, alpha polypeptide
SynonymscHKA, ATPase H+K+-transporting, alpha 2, Atp1al1, HKalpha2
MMRRC Submission 043223-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5842 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location56365068-56388550 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 56378290 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 503 (I503T)
Ref Sequence ENSEMBL: ENSMUSP00000007340 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007340]
Predicted Effect probably damaging
Transcript: ENSMUST00000007340
AA Change: I503T

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000007340
Gene: ENSMUSG00000022229
AA Change: I503T

DomainStartEndE-ValueType
low complexity region 22 36 N/A INTRINSIC
Cation_ATPase_N 54 128 9.27e-15 SMART
Pfam:E1-E2_ATPase 145 376 9.8e-57 PFAM
Pfam:Hydrolase 381 740 7.8e-20 PFAM
Pfam:HAD 384 737 7.6e-19 PFAM
Pfam:Cation_ATPase 437 532 3.4e-26 PFAM
Pfam:Cation_ATPase_C 810 1020 9.9e-44 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225567
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225698
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 97.1%
  • 20x: 90.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases. This gene encodes a catalytic subunit of the ouabain-sensitive H+/K+ -ATPase that catalyzes the hydrolysis of ATP coupled with the exchange of H(+) and K(+) ions across the plasma membrane. It is also responsible for potassium absorption in various tissues. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2010]
PHENOTYPE: Homozygous mutation of this gene results in increased potassium excretion. When placed on a potassium-free diet, mutant animals display greater weight loss and slightly increased kidney weight compared to wild-type. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alpk1 G A 3: 127,680,969 H462Y probably damaging Het
Bmp6 T A 13: 38,346,567 V212D probably damaging Het
Col7a1 A G 9: 108,965,815 D1479G unknown Het
Eea1 A G 10: 96,018,124 D548G probably damaging Het
Eif5a2 T C 3: 28,794,397 V135A probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fstl5 T G 3: 76,322,283 N130K possibly damaging Het
Gatm T C 2: 122,603,627 I147V probably benign Het
Jakmip1 C T 5: 37,107,268 R418C probably damaging Het
Kmt2d G A 15: 98,852,109 probably benign Het
Matn2 A T 15: 34,399,056 D363V probably damaging Het
Mov10 G A 3: 104,799,379 probably benign Het
Mtpn C T 6: 35,512,290 D100N probably benign Het
Nbas T C 12: 13,269,266 probably null Het
Nlgn1 A T 3: 26,133,743 probably null Het
Nnt T A 13: 119,394,747 I155F probably damaging Het
Olfr508 A G 7: 108,630,652 Y220C probably benign Het
Parp9 A G 16: 35,943,408 I19V possibly damaging Het
Pcdha11 T A 18: 37,011,284 S143T possibly damaging Het
Pdzph1 T G 17: 58,974,412 S292R possibly damaging Het
Pmvk T A 3: 89,467,620 V108D probably damaging Het
Ppil2 T C 16: 17,094,987 T26A possibly damaging Het
Rc3h2 T C 2: 37,378,371 T916A possibly damaging Het
Slc23a1 T A 18: 35,622,882 I393F probably damaging Het
Slc4a7 T A 14: 14,778,866 M925K probably damaging Het
Spag17 A G 3: 99,939,250 D30G possibly damaging Het
Syde2 A G 3: 145,999,020 I576V probably benign Het
Tgm2 C T 2: 158,143,081 R35H probably damaging Het
Tiam1 A G 16: 89,855,999 V745A probably benign Het
Timeless T C 10: 128,247,459 probably null Het
Tmem206 G T 1: 191,346,789 C223F probably damaging Het
Trp53tg5 T C 2: 164,471,369 K129E possibly damaging Het
Ttc6 T C 12: 57,737,016 Y1754H probably damaging Het
Ube4b G T 4: 149,331,430 T1069N probably benign Het
Ugcg C T 4: 59,219,545 S294L possibly damaging Het
Vgll2 T C 10: 52,025,292 L106P probably damaging Het
Vsig10l T A 7: 43,468,972 V798E probably benign Het
Wdr73 A T 7: 80,891,710 H361Q probably damaging Het
Xrcc3 A T 12: 111,804,530 F322I possibly damaging Het
Other mutations in Atp12a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01382:Atp12a APN 14 56379955 missense probably damaging 1.00
IGL02108:Atp12a APN 14 56384068 missense possibly damaging 0.95
IGL02176:Atp12a APN 14 56387179 missense probably damaging 1.00
IGL02210:Atp12a APN 14 56371744 nonsense probably null
IGL02828:Atp12a APN 14 56376142 missense possibly damaging 0.72
IGL02868:Atp12a APN 14 56384182 missense probably damaging 1.00
IGL02876:Atp12a APN 14 56373289 missense probably benign 0.00
R0045:Atp12a UTSW 14 56372873 missense probably damaging 1.00
R0172:Atp12a UTSW 14 56372844 missense probably damaging 1.00
R0276:Atp12a UTSW 14 56387694 missense probably damaging 1.00
R0613:Atp12a UTSW 14 56374521 missense probably damaging 1.00
R0656:Atp12a UTSW 14 56374481 missense probably damaging 1.00
R0962:Atp12a UTSW 14 56368413 missense probably damaging 1.00
R1067:Atp12a UTSW 14 56373436 missense probably damaging 1.00
R1448:Atp12a UTSW 14 56385839 missense probably damaging 1.00
R1503:Atp12a UTSW 14 56373424 missense probably damaging 1.00
R1590:Atp12a UTSW 14 56380055 missense probably damaging 1.00
R1639:Atp12a UTSW 14 56384068 missense possibly damaging 0.95
R1660:Atp12a UTSW 14 56370848 missense probably benign 0.21
R1696:Atp12a UTSW 14 56366088 missense probably damaging 1.00
R1775:Atp12a UTSW 14 56372589 missense probably benign 0.23
R1920:Atp12a UTSW 14 56386851 missense probably benign 0.19
R2022:Atp12a UTSW 14 56365282 start codon destroyed probably null
R2071:Atp12a UTSW 14 56366009 missense probably benign
R2253:Atp12a UTSW 14 56376258 missense probably benign 0.03
R2289:Atp12a UTSW 14 56373262 missense possibly damaging 0.93
R2567:Atp12a UTSW 14 56386927 missense probably damaging 1.00
R2870:Atp12a UTSW 14 56386950 missense possibly damaging 0.94
R2870:Atp12a UTSW 14 56386950 missense possibly damaging 0.94
R2872:Atp12a UTSW 14 56386950 missense possibly damaging 0.94
R2872:Atp12a UTSW 14 56386950 missense possibly damaging 0.94
R2873:Atp12a UTSW 14 56386950 missense possibly damaging 0.94
R2923:Atp12a UTSW 14 56374622 missense probably benign
R3736:Atp12a UTSW 14 56374427 missense possibly damaging 0.90
R3754:Atp12a UTSW 14 56372588 missense probably benign 0.01
R5028:Atp12a UTSW 14 56386978 missense probably damaging 0.96
R5267:Atp12a UTSW 14 56384211 missense probably damaging 1.00
R5481:Atp12a UTSW 14 56373389 missense possibly damaging 0.90
R5590:Atp12a UTSW 14 56373380 missense probably benign 0.11
R5899:Atp12a UTSW 14 56373344 missense probably benign 0.44
R5985:Atp12a UTSW 14 56384341 missense probably damaging 1.00
R6044:Atp12a UTSW 14 56376155 missense probably damaging 1.00
R6271:Atp12a UTSW 14 56378422 missense probably benign 0.00
R6454:Atp12a UTSW 14 56370833 missense probably benign 0.02
R6461:Atp12a UTSW 14 56373238 missense probably damaging 1.00
R6610:Atp12a UTSW 14 56374556 missense probably damaging 1.00
R6666:Atp12a UTSW 14 56373364 missense probably benign 0.36
R6667:Atp12a UTSW 14 56384188 missense possibly damaging 0.82
R6677:Atp12a UTSW 14 56380854 missense probably damaging 1.00
R6791:Atp12a UTSW 14 56386982 critical splice donor site probably null
R7003:Atp12a UTSW 14 56373380 missense possibly damaging 0.87
R7173:Atp12a UTSW 14 56384380 missense probably damaging 1.00
X0004:Atp12a UTSW 14 56378467 missense probably benign 0.16
Z1088:Atp12a UTSW 14 56386141 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- CAAAAGACAGGCTACACTTGG -3'
(R):5'- ATGGCTTCTCTGCTAGTGGC -3'

Sequencing Primer
(F):5'- CACTTGGGAGTGTCATGATTCTTCC -3'
(R):5'- AGTGGCACTTCTTTCATGGC -3'
Posted On2016-12-20