Incidental Mutation 'R5843:Atp6v1h'
ID450520
Institutional Source Beutler Lab
Gene Symbol Atp6v1h
Ensembl Gene ENSMUSG00000033793
Gene NameATPase, H+ transporting, lysosomal V1 subunit H
Synonyms0710001F19Rik
MMRRC Submission 043224-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5843 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location5070018-5162529 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to A at 5162089 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000141636 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044369] [ENSMUST00000192698] [ENSMUST00000192847]
Predicted Effect probably null
Transcript: ENSMUST00000044369
SMART Domains Protein: ENSMUSP00000040756
Gene: ENSMUSG00000033793

DomainStartEndE-ValueType
Pfam:V-ATPase_H_N 17 342 3e-106 PFAM
Pfam:V-ATPase_H_C 348 464 1.9e-49 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000192698
SMART Domains Protein: ENSMUSP00000141797
Gene: ENSMUSG00000033793

DomainStartEndE-ValueType
Pfam:V-ATPase_H_N 17 324 4.4e-104 PFAM
Pfam:V-ATPase_H_C 329 447 1.7e-48 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000192847
SMART Domains Protein: ENSMUSP00000141636
Gene: ENSMUSG00000033793

DomainStartEndE-ValueType
Pfam:V-ATPase_H_N 17 342 1e-102 PFAM
Pfam:V-ATPase_H_C 332 423 2.7e-25 PFAM
Pfam:Arm_2 339 427 4.6e-5 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of vacuolar ATPase (V-ATPase), a multisubunit enzyme that mediates acidification of intracellular organelles. V-ATPase-dependent organelle acidification is necessary for multiple processes including protein sorting, zymogen activation, receptor-mediated endocytosis, and synaptic vesicle proton gradient generation. The encoded protein is the regulatory H subunit of the V1 domain of V-ATPase, which is required for catalysis of ATP but not the assembly of V-ATPase. Decreased expression of this gene may play a role in the development of type 2 diabetes. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, May 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality. Mice heterozygous for the allele exhbit bone loss with altered bone absorption and decreased bone formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agap1 A G 1: 89,609,550 T93A probably damaging Het
Ccnk T C 12: 108,193,730 V157A probably damaging Het
Cdh10 T C 15: 18,985,200 F317L possibly damaging Het
Chn1 A G 2: 73,679,748 I139T probably benign Het
Creld2 A T 15: 88,826,429 D349V probably damaging Het
Dnah3 TTCCTC TTC 7: 119,951,021 probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Frem1 T C 4: 82,936,052 D1660G probably damaging Het
Hipk3 A C 2: 104,440,224 S470R possibly damaging Het
Hook2 T A 8: 84,991,283 I37K probably damaging Het
Hpcal1 T C 12: 17,791,199 F193L probably benign Het
Hps4 T C 5: 112,349,430 probably null Het
Iqgap1 T C 7: 80,726,080 N1349S probably benign Het
Khk A G 5: 30,921,931 I6V possibly damaging Het
Kmt2d G A 15: 98,852,109 probably benign Het
Lrch3 T C 16: 32,998,526 V629A probably damaging Het
Mtpn C T 6: 35,512,290 D100N probably benign Het
Muc13 A G 16: 33,806,051 Y320C probably damaging Het
Olfr10 A T 11: 49,318,249 R234S probably benign Het
Olfr169 T A 16: 19,566,583 Q100L probably damaging Het
Olfr203 T A 16: 59,303,361 D69E probably damaging Het
Parpbp A G 10: 88,133,191 L131P probably damaging Het
Prl3a1 T C 13: 27,270,110 W24R probably damaging Het
Ptprk T A 10: 28,493,064 N677K probably damaging Het
Rbm39 A T 2: 156,162,873 D181E possibly damaging Het
Ros1 T C 10: 52,166,197 T220A possibly damaging Het
Slc46a3 T C 5: 147,886,211 I274V probably benign Het
Tas2r104 T A 6: 131,684,975 N257I probably damaging Het
Timeless A G 10: 128,244,244 probably null Het
Tmem63a T C 1: 180,972,833 probably null Het
Traf5 T C 1: 191,997,485 D535G possibly damaging Het
Trank1 C T 9: 111,365,860 S984L possibly damaging Het
Trpm6 A G 19: 18,856,175 T1573A probably benign Het
Ube3b T A 5: 114,412,299 I835N probably damaging Het
Wnt16 T A 6: 22,290,948 I125N probably damaging Het
Xirp2 G T 2: 67,476,785 probably benign Het
Zc3h12c G T 9: 52,116,682 T460K probably benign Het
Zfp651 T C 9: 121,767,339 F624S possibly damaging Het
Zfp865 C A 7: 5,030,417 T467K probably benign Het
Zim1 A G 7: 6,677,698 V322A possibly damaging Het
Other mutations in Atp6v1h
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00671:Atp6v1h APN 1 5124471 critical splice donor site probably null
IGL00984:Atp6v1h APN 1 5095682 missense probably damaging 1.00
IGL01545:Atp6v1h APN 1 5089059 missense probably benign
IGL01788:Atp6v1h APN 1 5149983 missense possibly damaging 0.81
IGL02317:Atp6v1h APN 1 5084470 missense possibly damaging 0.95
IGL02679:Atp6v1h APN 1 5124302 missense probably damaging 1.00
IGL02944:Atp6v1h APN 1 5093355 splice site probably benign
IGL03119:Atp6v1h APN 1 5095669 missense probably benign 0.34
F5770:Atp6v1h UTSW 1 5124443 missense possibly damaging 0.94
R0055:Atp6v1h UTSW 1 5084454 missense probably benign 0.01
R0055:Atp6v1h UTSW 1 5084454 missense probably benign 0.01
R0727:Atp6v1h UTSW 1 5084558 nonsense probably null
R1452:Atp6v1h UTSW 1 5098137 unclassified probably benign
R1465:Atp6v1h UTSW 1 5095688 missense probably damaging 1.00
R1465:Atp6v1h UTSW 1 5095688 missense probably damaging 1.00
R2273:Atp6v1h UTSW 1 5117476 missense probably damaging 1.00
R4512:Atp6v1h UTSW 1 5098135 critical splice donor site probably null
R4687:Atp6v1h UTSW 1 5133085 missense probably damaging 1.00
R5185:Atp6v1h UTSW 1 5095642 missense probably damaging 1.00
R5628:Atp6v1h UTSW 1 5135889 nonsense probably null
R7037:Atp6v1h UTSW 1 5149992 missense possibly damaging 0.77
V7580:Atp6v1h UTSW 1 5124443 missense possibly damaging 0.94
V7581:Atp6v1h UTSW 1 5124443 missense possibly damaging 0.94
V7582:Atp6v1h UTSW 1 5124443 missense possibly damaging 0.94
V7583:Atp6v1h UTSW 1 5124443 missense possibly damaging 0.94
Z1088:Atp6v1h UTSW 1 5098048 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTCCTTCATGTAAAGAGGGAAGTC -3'
(R):5'- TATTCTCCCAGGAATTACCATAGGG -3'

Sequencing Primer
(F):5'- GGAAGTCAACCCTGCAAATGGC -3'
(R):5'- TCCCAGGAATTACCATAGGGAAAAGC -3'
Posted On2016-12-20