Incidental Mutation 'R5843:Khk'
ID450532
Institutional Source Beutler Lab
Gene Symbol Khk
Ensembl Gene ENSMUSG00000029162
Gene Nameketohexokinase
Synonyms
MMRRC Submission 043224-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.154) question?
Stock #R5843 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location30921431-30931248 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 30921931 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 6 (I6V)
Ref Sequence ENSEMBL: ENSMUSP00000031053 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031053] [ENSMUST00000031055] [ENSMUST00000201571] [ENSMUST00000201621] [ENSMUST00000202752]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031053
AA Change: I6V

PolyPhen 2 Score 0.546 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000031053
Gene: ENSMUSG00000029162
AA Change: I6V

DomainStartEndE-ValueType
Pfam:PfkB 3 293 5.7e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000031055
SMART Domains Protein: ENSMUSP00000031055
Gene: ENSMUSG00000029163

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:EMI 57 128 1.2e-19 PFAM
low complexity region 141 155 N/A INTRINSIC
low complexity region 157 171 N/A INTRINSIC
coiled coil region 174 210 N/A INTRINSIC
coiled coil region 237 263 N/A INTRINSIC
coiled coil region 310 342 N/A INTRINSIC
low complexity region 389 400 N/A INTRINSIC
internal_repeat_1 422 474 9.62e-7 PROSPERO
coiled coil region 527 563 N/A INTRINSIC
low complexity region 606 627 N/A INTRINSIC
low complexity region 629 639 N/A INTRINSIC
internal_repeat_1 704 758 9.62e-7 PROSPERO
low complexity region 780 810 N/A INTRINSIC
Pfam:Collagen 813 870 3.3e-10 PFAM
Pfam:C1q 873 1008 1e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123885
AA Change: I6V

PolyPhen 2 Score 0.073 (Sensitivity: 0.93; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000114540
Gene: ENSMUSG00000029162
AA Change: I6V

DomainStartEndE-ValueType
Pfam:PfkB 3 243 2.5e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201169
Predicted Effect probably benign
Transcript: ENSMUST00000201571
AA Change: I6V

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000144226
Gene: ENSMUSG00000029162
AA Change: I6V

DomainStartEndE-ValueType
Pfam:PfkB 3 70 2.4e-5 PFAM
Pfam:PfkB 65 249 4.5e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000201621
AA Change: I6V

PolyPhen 2 Score 0.131 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000144050
Gene: ENSMUSG00000029162
AA Change: I6V

DomainStartEndE-ValueType
Pfam:PfkB 3 294 1.5e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202368
Predicted Effect probably benign
Transcript: ENSMUST00000202752
AA Change: I6V

PolyPhen 2 Score 0.392 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000143850
Gene: ENSMUSG00000029162
AA Change: I6V

DomainStartEndE-ValueType
Pfam:PfkB 3 243 5.8e-18 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes ketohexokinase that catalyzes conversion of fructose to fructose-1-phosphate. The product of this gene is the first enzyme with a specialized pathway that catabolizes dietary fructose. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for alleles that do not produce isoform A or isoforms A and C exhibit normal fertility, development, blood chemistry, and tissue metabolite levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agap1 A G 1: 89,609,550 T93A probably damaging Het
Atp6v1h T A 1: 5,162,089 probably null Het
Ccnk T C 12: 108,193,730 V157A probably damaging Het
Cdh10 T C 15: 18,985,200 F317L possibly damaging Het
Chn1 A G 2: 73,679,748 I139T probably benign Het
Creld2 A T 15: 88,826,429 D349V probably damaging Het
Dnah3 TTCCTC TTC 7: 119,951,021 probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Frem1 T C 4: 82,936,052 D1660G probably damaging Het
Hipk3 A C 2: 104,440,224 S470R possibly damaging Het
Hook2 T A 8: 84,991,283 I37K probably damaging Het
Hpcal1 T C 12: 17,791,199 F193L probably benign Het
Hps4 T C 5: 112,349,430 probably null Het
Iqgap1 T C 7: 80,726,080 N1349S probably benign Het
Kmt2d G A 15: 98,852,109 probably benign Het
Lrch3 T C 16: 32,998,526 V629A probably damaging Het
Mtpn C T 6: 35,512,290 D100N probably benign Het
Muc13 A G 16: 33,806,051 Y320C probably damaging Het
Olfr10 A T 11: 49,318,249 R234S probably benign Het
Olfr169 T A 16: 19,566,583 Q100L probably damaging Het
Olfr203 T A 16: 59,303,361 D69E probably damaging Het
Parpbp A G 10: 88,133,191 L131P probably damaging Het
Prl3a1 T C 13: 27,270,110 W24R probably damaging Het
Ptprk T A 10: 28,493,064 N677K probably damaging Het
Rbm39 A T 2: 156,162,873 D181E possibly damaging Het
Ros1 T C 10: 52,166,197 T220A possibly damaging Het
Slc46a3 T C 5: 147,886,211 I274V probably benign Het
Tas2r104 T A 6: 131,684,975 N257I probably damaging Het
Timeless A G 10: 128,244,244 probably null Het
Tmem63a T C 1: 180,972,833 probably null Het
Traf5 T C 1: 191,997,485 D535G possibly damaging Het
Trank1 C T 9: 111,365,860 S984L possibly damaging Het
Trpm6 A G 19: 18,856,175 T1573A probably benign Het
Ube3b T A 5: 114,412,299 I835N probably damaging Het
Wnt16 T A 6: 22,290,948 I125N probably damaging Het
Xirp2 G T 2: 67,476,785 probably benign Het
Zc3h12c G T 9: 52,116,682 T460K probably benign Het
Zfp651 T C 9: 121,767,339 F624S possibly damaging Het
Zfp865 C A 7: 5,030,417 T467K probably benign Het
Zim1 A G 7: 6,677,698 V322A possibly damaging Het
Other mutations in Khk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00662:Khk APN 5 30929675 critical splice donor site probably benign 0.00
IGL01551:Khk APN 5 30924845 missense probably benign 0.00
IGL02351:Khk APN 5 30928504 missense probably damaging 1.00
IGL02358:Khk APN 5 30928504 missense probably damaging 1.00
IGL03355:Khk APN 5 30929560 missense probably benign 0.44
R1608:Khk UTSW 5 30930594 missense probably damaging 1.00
R1916:Khk UTSW 5 30930618 missense probably damaging 1.00
R3816:Khk UTSW 5 30926716 missense probably damaging 1.00
R3855:Khk UTSW 5 30927057 missense probably benign 0.04
R5033:Khk UTSW 5 30929660 missense probably damaging 1.00
R5310:Khk UTSW 5 30927029 missense probably benign 0.08
R5878:Khk UTSW 5 30930875 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGCATTACTAGTGCGCTTTCG -3'
(R):5'- CTATCCCTGGTTTAGCAGCC -3'

Sequencing Primer
(F):5'- ATTGGCCGGGCTAGGTAAC -3'
(R):5'- TTTAGCAGCCGATTAGCAGTGAC -3'
Posted On2016-12-20