Incidental Mutation 'R5843:Zc3h12c'
ID450545
Institutional Source Beutler Lab
Gene Symbol Zc3h12c
Ensembl Gene ENSMUSG00000035164
Gene Namezinc finger CCCH type containing 12C
SynonymsC230027N18Rik
MMRRC Submission 043224-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5843 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location52111344-52168572 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 52116682 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 460 (T460K)
Ref Sequence ENSEMBL: ENSMUSP00000150821 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165519] [ENSMUST00000213645]
Predicted Effect probably benign
Transcript: ENSMUST00000165519
AA Change: T479K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000127603
Gene: ENSMUSG00000035164
AA Change: T479K

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 53 65 N/A INTRINSIC
low complexity region 106 121 N/A INTRINSIC
Pfam:RNase_Zc3h12a 264 420 1.6e-67 PFAM
low complexity region 644 659 N/A INTRINSIC
low complexity region 746 758 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184156
Predicted Effect probably benign
Transcript: ENSMUST00000213645
AA Change: T460K

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agap1 A G 1: 89,609,550 T93A probably damaging Het
Atp6v1h T A 1: 5,162,089 probably null Het
Ccnk T C 12: 108,193,730 V157A probably damaging Het
Cdh10 T C 15: 18,985,200 F317L possibly damaging Het
Chn1 A G 2: 73,679,748 I139T probably benign Het
Creld2 A T 15: 88,826,429 D349V probably damaging Het
Dnah3 TTCCTC TTC 7: 119,951,021 probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Frem1 T C 4: 82,936,052 D1660G probably damaging Het
Hipk3 A C 2: 104,440,224 S470R possibly damaging Het
Hook2 T A 8: 84,991,283 I37K probably damaging Het
Hpcal1 T C 12: 17,791,199 F193L probably benign Het
Hps4 T C 5: 112,349,430 probably null Het
Iqgap1 T C 7: 80,726,080 N1349S probably benign Het
Khk A G 5: 30,921,931 I6V possibly damaging Het
Kmt2d G A 15: 98,852,109 probably benign Het
Lrch3 T C 16: 32,998,526 V629A probably damaging Het
Mtpn C T 6: 35,512,290 D100N probably benign Het
Muc13 A G 16: 33,806,051 Y320C probably damaging Het
Olfr10 A T 11: 49,318,249 R234S probably benign Het
Olfr169 T A 16: 19,566,583 Q100L probably damaging Het
Olfr203 T A 16: 59,303,361 D69E probably damaging Het
Parpbp A G 10: 88,133,191 L131P probably damaging Het
Prl3a1 T C 13: 27,270,110 W24R probably damaging Het
Ptprk T A 10: 28,493,064 N677K probably damaging Het
Rbm39 A T 2: 156,162,873 D181E possibly damaging Het
Ros1 T C 10: 52,166,197 T220A possibly damaging Het
Slc46a3 T C 5: 147,886,211 I274V probably benign Het
Tas2r104 T A 6: 131,684,975 N257I probably damaging Het
Timeless A G 10: 128,244,244 probably null Het
Tmem63a T C 1: 180,972,833 probably null Het
Traf5 T C 1: 191,997,485 D535G possibly damaging Het
Trank1 C T 9: 111,365,860 S984L possibly damaging Het
Trpm6 A G 19: 18,856,175 T1573A probably benign Het
Ube3b T A 5: 114,412,299 I835N probably damaging Het
Wnt16 T A 6: 22,290,948 I125N probably damaging Het
Xirp2 G T 2: 67,476,785 probably benign Het
Zfp651 T C 9: 121,767,339 F624S possibly damaging Het
Zfp865 C A 7: 5,030,417 T467K probably benign Het
Zim1 A G 7: 6,677,698 V322A possibly damaging Het
Other mutations in Zc3h12c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Zc3h12c APN 9 52116665 missense probably damaging 1.00
IGL01288:Zc3h12c APN 9 52117651 splice site probably benign
IGL01993:Zc3h12c APN 9 52116311 missense probably damaging 1.00
R0035:Zc3h12c UTSW 9 52143747 missense probably benign 0.04
R0035:Zc3h12c UTSW 9 52143747 missense probably benign 0.04
R0131:Zc3h12c UTSW 9 52126623 missense possibly damaging 0.87
R0240:Zc3h12c UTSW 9 52144083 missense possibly damaging 0.77
R0240:Zc3h12c UTSW 9 52144083 missense possibly damaging 0.77
R1762:Zc3h12c UTSW 9 52115781 missense probably benign 0.17
R2101:Zc3h12c UTSW 9 52116421 missense probably benign 0.01
R3052:Zc3h12c UTSW 9 52144056 missense possibly damaging 0.94
R3689:Zc3h12c UTSW 9 52115956 missense probably benign 0.00
R4163:Zc3h12c UTSW 9 52115699 missense probably damaging 1.00
R4230:Zc3h12c UTSW 9 52144428 critical splice acceptor site probably null
R4803:Zc3h12c UTSW 9 52116553 missense probably damaging 1.00
R5008:Zc3h12c UTSW 9 52116700 missense probably benign 0.00
R5153:Zc3h12c UTSW 9 52126647 missense probably damaging 1.00
R5682:Zc3h12c UTSW 9 52126576 missense probably damaging 1.00
R6613:Zc3h12c UTSW 9 52116112 missense possibly damaging 0.65
R7097:Zc3h12c UTSW 9 52115926 missense possibly damaging 0.77
R7460:Zc3h12c UTSW 9 52144102 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- GTGGCCGGGATACTAACTAAG -3'
(R):5'- TTACACACGTTCAGATAGCCCC -3'

Sequencing Primer
(F):5'- CCGGGATACTAACTAAGGAAGGTAC -3'
(R):5'- CTCACTGACTGTGCAGGAC -3'
Posted On2016-12-20