Incidental Mutation 'R5843:Parpbp'
ID450551
Institutional Source Beutler Lab
Gene Symbol Parpbp
Ensembl Gene ENSMUSG00000035365
Gene NamePARP1 binding protein
Synonyms
MMRRC Submission 043224-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5843 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location88091432-88146941 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 88133191 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 131 (L131P)
Ref Sequence ENSEMBL: ENSMUSP00000128043 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048518] [ENSMUST00000164121] [ENSMUST00000164803] [ENSMUST00000168163]
Predicted Effect probably damaging
Transcript: ENSMUST00000048518
AA Change: L131P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000038375
Gene: ENSMUSG00000035365
AA Change: L131P

DomainStartEndE-ValueType
SCOP:d1pjr_2 154 268 8e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000164121
AA Change: L131P

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000130777
Gene: ENSMUSG00000035365
AA Change: L131P

DomainStartEndE-ValueType
SCOP:d1pjr_2 154 202 4e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000164803
AA Change: L131P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000168163
AA Change: L131P

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218063
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218993
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agap1 A G 1: 89,609,550 T93A probably damaging Het
Atp6v1h T A 1: 5,162,089 probably null Het
Ccnk T C 12: 108,193,730 V157A probably damaging Het
Cdh10 T C 15: 18,985,200 F317L possibly damaging Het
Chn1 A G 2: 73,679,748 I139T probably benign Het
Creld2 A T 15: 88,826,429 D349V probably damaging Het
Dnah3 TTCCTC TTC 7: 119,951,021 probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Frem1 T C 4: 82,936,052 D1660G probably damaging Het
Hipk3 A C 2: 104,440,224 S470R possibly damaging Het
Hook2 T A 8: 84,991,283 I37K probably damaging Het
Hpcal1 T C 12: 17,791,199 F193L probably benign Het
Hps4 T C 5: 112,349,430 probably null Het
Iqgap1 T C 7: 80,726,080 N1349S probably benign Het
Khk A G 5: 30,921,931 I6V possibly damaging Het
Kmt2d G A 15: 98,852,109 probably benign Het
Lrch3 T C 16: 32,998,526 V629A probably damaging Het
Mtpn C T 6: 35,512,290 D100N probably benign Het
Muc13 A G 16: 33,806,051 Y320C probably damaging Het
Olfr10 A T 11: 49,318,249 R234S probably benign Het
Olfr169 T A 16: 19,566,583 Q100L probably damaging Het
Olfr203 T A 16: 59,303,361 D69E probably damaging Het
Prl3a1 T C 13: 27,270,110 W24R probably damaging Het
Ptprk T A 10: 28,493,064 N677K probably damaging Het
Rbm39 A T 2: 156,162,873 D181E possibly damaging Het
Ros1 T C 10: 52,166,197 T220A possibly damaging Het
Slc46a3 T C 5: 147,886,211 I274V probably benign Het
Tas2r104 T A 6: 131,684,975 N257I probably damaging Het
Timeless A G 10: 128,244,244 probably null Het
Tmem63a T C 1: 180,972,833 probably null Het
Traf5 T C 1: 191,997,485 D535G possibly damaging Het
Trank1 C T 9: 111,365,860 S984L possibly damaging Het
Trpm6 A G 19: 18,856,175 T1573A probably benign Het
Ube3b T A 5: 114,412,299 I835N probably damaging Het
Wnt16 T A 6: 22,290,948 I125N probably damaging Het
Xirp2 G T 2: 67,476,785 probably benign Het
Zc3h12c G T 9: 52,116,682 T460K probably benign Het
Zfp651 T C 9: 121,767,339 F624S possibly damaging Het
Zfp865 C A 7: 5,030,417 T467K probably benign Het
Zim1 A G 7: 6,677,698 V322A possibly damaging Het
Other mutations in Parpbp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01386:Parpbp APN 10 88139986 nonsense probably null
IGL02058:Parpbp APN 10 88144036 missense probably benign 0.03
IGL02222:Parpbp APN 10 88140085 missense possibly damaging 0.95
IGL02976:Parpbp APN 10 88111594 critical splice donor site probably null
IGL03013:Parpbp APN 10 88139978 missense probably damaging 0.96
PIT4468001:Parpbp UTSW 10 88144073 missense probably benign 0.00
PIT4544001:Parpbp UTSW 10 88114549 missense possibly damaging 0.90
R0145:Parpbp UTSW 10 88093009 missense possibly damaging 0.76
R0201:Parpbp UTSW 10 88092896 missense possibly damaging 0.46
R0471:Parpbp UTSW 10 88093707 missense probably damaging 0.96
R2057:Parpbp UTSW 10 88124962 missense probably benign 0.00
R2350:Parpbp UTSW 10 88133088 splice site probably benign
R4551:Parpbp UTSW 10 88093702 missense possibly damaging 0.82
R4552:Parpbp UTSW 10 88093702 missense possibly damaging 0.82
R5951:Parpbp UTSW 10 88139907 missense probably damaging 0.99
R6003:Parpbp UTSW 10 88133158 missense possibly damaging 0.71
R6656:Parpbp UTSW 10 88110313 missense probably benign
R7081:Parpbp UTSW 10 88093655 missense probably damaging 0.99
R7240:Parpbp UTSW 10 88124940 missense probably damaging 0.99
R7334:Parpbp UTSW 10 88111755 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CACCAGATCCATTTATAACCCTGATG -3'
(R):5'- CCCTTCCCAACCATGGTAATTG -3'

Sequencing Primer
(F):5'- AGATTCACTGATAACCCTGATGAATG -3'
(R):5'- TCCCAACCATGGTAATTGTTTATC -3'
Posted On2016-12-20