Incidental Mutation 'R5843:Ccnk'
ID450556
Institutional Source Beutler Lab
Gene Symbol Ccnk
Ensembl Gene ENSMUSG00000021258
Gene Namecyclin K
SynonymsCycK, CPR4
MMRRC Submission 043224-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5843 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location108179579-108203359 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 108193730 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 157 (V157A)
Ref Sequence ENSEMBL: ENSMUSP00000152784 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101055] [ENSMUST00000221167]
Predicted Effect probably damaging
Transcript: ENSMUST00000101055
AA Change: V157A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000098616
Gene: ENSMUSG00000021258
AA Change: V157A

DomainStartEndE-ValueType
CYCLIN 55 149 6.67e-16 SMART
Cyclin_C 158 278 4.83e-1 SMART
CYCLIN 162 256 1.23e-1 SMART
low complexity region 342 361 N/A INTRINSIC
low complexity region 365 392 N/A INTRINSIC
low complexity region 404 427 N/A INTRINSIC
low complexity region 428 446 N/A INTRINSIC
low complexity region 457 471 N/A INTRINSIC
low complexity region 476 576 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000221167
AA Change: V157A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the transcription cyclin family. These cyclins may regulate transcription through their association with and activation of cyclin-dependent kinases (CDK) that phosphorylate the C-terminal domain (CTD) of the large subunit of RNA polymerase II. This gene product may play a dual role in regulating CDK and RNA polymerase II activities. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele display complete embryonic lethality before implantation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agap1 A G 1: 89,609,550 T93A probably damaging Het
Atp6v1h T A 1: 5,162,089 probably null Het
Cdh10 T C 15: 18,985,200 F317L possibly damaging Het
Chn1 A G 2: 73,679,748 I139T probably benign Het
Creld2 A T 15: 88,826,429 D349V probably damaging Het
Dnah3 TTCCTC TTC 7: 119,951,021 probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Frem1 T C 4: 82,936,052 D1660G probably damaging Het
Hipk3 A C 2: 104,440,224 S470R possibly damaging Het
Hook2 T A 8: 84,991,283 I37K probably damaging Het
Hpcal1 T C 12: 17,791,199 F193L probably benign Het
Hps4 T C 5: 112,349,430 probably null Het
Iqgap1 T C 7: 80,726,080 N1349S probably benign Het
Khk A G 5: 30,921,931 I6V possibly damaging Het
Kmt2d G A 15: 98,852,109 probably benign Het
Lrch3 T C 16: 32,998,526 V629A probably damaging Het
Mtpn C T 6: 35,512,290 D100N probably benign Het
Muc13 A G 16: 33,806,051 Y320C probably damaging Het
Olfr10 A T 11: 49,318,249 R234S probably benign Het
Olfr169 T A 16: 19,566,583 Q100L probably damaging Het
Olfr203 T A 16: 59,303,361 D69E probably damaging Het
Parpbp A G 10: 88,133,191 L131P probably damaging Het
Prl3a1 T C 13: 27,270,110 W24R probably damaging Het
Ptprk T A 10: 28,493,064 N677K probably damaging Het
Rbm39 A T 2: 156,162,873 D181E possibly damaging Het
Ros1 T C 10: 52,166,197 T220A possibly damaging Het
Slc46a3 T C 5: 147,886,211 I274V probably benign Het
Tas2r104 T A 6: 131,684,975 N257I probably damaging Het
Timeless A G 10: 128,244,244 probably null Het
Tmem63a T C 1: 180,972,833 probably null Het
Traf5 T C 1: 191,997,485 D535G possibly damaging Het
Trank1 C T 9: 111,365,860 S984L possibly damaging Het
Trpm6 A G 19: 18,856,175 T1573A probably benign Het
Ube3b T A 5: 114,412,299 I835N probably damaging Het
Wnt16 T A 6: 22,290,948 I125N probably damaging Het
Xirp2 G T 2: 67,476,785 probably benign Het
Zc3h12c G T 9: 52,116,682 T460K probably benign Het
Zfp651 T C 9: 121,767,339 F624S possibly damaging Het
Zfp865 C A 7: 5,030,417 T467K probably benign Het
Zim1 A G 7: 6,677,698 V322A possibly damaging Het
Other mutations in Ccnk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02331:Ccnk APN 12 108189084 missense probably damaging 1.00
IGL02341:Ccnk APN 12 108195730 missense unknown
IGL02557:Ccnk APN 12 108195726 missense unknown
FR4449:Ccnk UTSW 12 108202507 unclassified probably benign
FR4737:Ccnk UTSW 12 108202507 unclassified probably benign
FR4976:Ccnk UTSW 12 108202507 unclassified probably benign
R0481:Ccnk UTSW 12 108199309 unclassified probably benign
R0725:Ccnk UTSW 12 108195575 splice site probably benign
R1839:Ccnk UTSW 12 108195074 missense probably damaging 1.00
R2144:Ccnk UTSW 12 108189090 missense probably null 1.00
R2903:Ccnk UTSW 12 108202388 unclassified probably benign
R4660:Ccnk UTSW 12 108202316 unclassified probably benign
R5131:Ccnk UTSW 12 108202631 unclassified probably benign
R5404:Ccnk UTSW 12 108195623 missense possibly damaging 0.88
R5860:Ccnk UTSW 12 108187207 missense probably damaging 0.99
R6522:Ccnk UTSW 12 108187187 missense probably damaging 0.99
R6864:Ccnk UTSW 12 108202214 unclassified probably benign
R7135:Ccnk UTSW 12 108186475 missense probably damaging 0.96
R7179:Ccnk UTSW 12 108187258 missense probably damaging 1.00
R7278:Ccnk UTSW 12 108193705 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- TCTGGGCGGTTTAGATTACTAC -3'
(R):5'- ACTGGCTTCTAGAATGGCAAG -3'

Sequencing Primer
(F):5'- CTACTGTGTGCTCATGTAACAGACTG -3'
(R):5'- GCTTCTAGAATGGCAAGTTTTTATG -3'
Posted On2016-12-20