Incidental Mutation 'R5843:Lrch3'
ID450562
Institutional Source Beutler Lab
Gene Symbol Lrch3
Ensembl Gene ENSMUSG00000022801
Gene Nameleucine-rich repeats and calponin homology (CH) domain containing 3
Synonyms2210409B11Rik, LOC385628
MMRRC Submission 043224-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R5843 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location32914100-33015647 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 32998526 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 629 (V629A)
Ref Sequence ENSEMBL: ENSMUSP00000126964 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023491] [ENSMUST00000135193] [ENSMUST00000165616] [ENSMUST00000165826] [ENSMUST00000170201] [ENSMUST00000170899]
Predicted Effect probably damaging
Transcript: ENSMUST00000023491
AA Change: V665A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000023491
Gene: ENSMUSG00000022801
AA Change: V665A

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 31 44 N/A INTRINSIC
LRR 104 126 2.54e1 SMART
LRR 127 150 2.86e-1 SMART
LRR 172 194 4.44e0 SMART
LRR 195 218 4.33e1 SMART
LRR 240 263 2.76e1 SMART
low complexity region 482 493 N/A INTRINSIC
low complexity region 539 554 N/A INTRINSIC
CH 651 754 9.24e-15 SMART
low complexity region 759 774 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000093713
Predicted Effect noncoding transcript
Transcript: ENSMUST00000105610
Predicted Effect probably damaging
Transcript: ENSMUST00000135193
AA Change: V665A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000130708
Gene: ENSMUSG00000022801
AA Change: V665A

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 31 44 N/A INTRINSIC
LRR 104 126 2.54e1 SMART
LRR 127 150 2.86e-1 SMART
LRR 172 194 4.44e0 SMART
LRR 195 218 4.33e1 SMART
LRR 240 263 2.76e1 SMART
low complexity region 482 493 N/A INTRINSIC
low complexity region 539 554 N/A INTRINSIC
CH 651 755 6.79e-13 SMART
transmembrane domain 771 793 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000142290
AA Change: V218A
SMART Domains Protein: ENSMUSP00000117302
Gene: ENSMUSG00000022801
AA Change: V218A

DomainStartEndE-ValueType
low complexity region 31 42 N/A INTRINSIC
low complexity region 88 103 N/A INTRINSIC
SCOP:d1h67a_ 201 253 1e-11 SMART
Blast:CH 205 253 6e-27 BLAST
Predicted Effect unknown
Transcript: ENSMUST00000163428
AA Change: V247A
SMART Domains Protein: ENSMUSP00000133034
Gene: ENSMUSG00000022801
AA Change: V247A

DomainStartEndE-ValueType
low complexity region 122 137 N/A INTRINSIC
SCOP:d1h67a_ 230 265 9e-5 SMART
Blast:CH 234 265 7e-14 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000165616
AA Change: V511A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000130009
Gene: ENSMUSG00000022801
AA Change: V511A

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 31 44 N/A INTRINSIC
Blast:LRR 89 113 1e-6 BLAST
Blast:LRR 114 137 3e-7 BLAST
low complexity region 328 339 N/A INTRINSIC
low complexity region 385 400 N/A INTRINSIC
CH 497 600 9.24e-15 SMART
low complexity region 605 620 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165826
SMART Domains Protein: ENSMUSP00000126308
Gene: ENSMUSG00000022801

DomainStartEndE-ValueType
low complexity region 105 116 N/A INTRINSIC
low complexity region 162 177 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000170201
AA Change: V629A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000126964
Gene: ENSMUSG00000022801
AA Change: V629A

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 31 44 N/A INTRINSIC
LRR 104 126 2.54e1 SMART
LRR 127 150 2.86e-1 SMART
LRR 172 194 4.44e0 SMART
LRR 195 218 4.33e1 SMART
LRR 240 263 2.76e1 SMART
low complexity region 482 493 N/A INTRINSIC
low complexity region 539 554 N/A INTRINSIC
CH 615 718 9.24e-15 SMART
low complexity region 723 738 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000170899
AA Change: V579A

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000127547
Gene: ENSMUSG00000022801
AA Change: V579A

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 31 44 N/A INTRINSIC
LRR 104 126 2.54e1 SMART
LRR 127 150 2.86e-1 SMART
LRR 172 194 4.44e0 SMART
LRR 195 218 4.33e1 SMART
LRR 240 263 2.76e1 SMART
low complexity region 489 504 N/A INTRINSIC
CH 565 668 9.24e-15 SMART
low complexity region 673 688 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agap1 A G 1: 89,609,550 T93A probably damaging Het
Atp6v1h T A 1: 5,162,089 probably null Het
Ccnk T C 12: 108,193,730 V157A probably damaging Het
Cdh10 T C 15: 18,985,200 F317L possibly damaging Het
Chn1 A G 2: 73,679,748 I139T probably benign Het
Creld2 A T 15: 88,826,429 D349V probably damaging Het
Dnah3 TTCCTC TTC 7: 119,951,021 probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Frem1 T C 4: 82,936,052 D1660G probably damaging Het
Hipk3 A C 2: 104,440,224 S470R possibly damaging Het
Hook2 T A 8: 84,991,283 I37K probably damaging Het
Hpcal1 T C 12: 17,791,199 F193L probably benign Het
Hps4 T C 5: 112,349,430 probably null Het
Iqgap1 T C 7: 80,726,080 N1349S probably benign Het
Khk A G 5: 30,921,931 I6V possibly damaging Het
Kmt2d G A 15: 98,852,109 probably benign Het
Mtpn C T 6: 35,512,290 D100N probably benign Het
Muc13 A G 16: 33,806,051 Y320C probably damaging Het
Olfr10 A T 11: 49,318,249 R234S probably benign Het
Olfr169 T A 16: 19,566,583 Q100L probably damaging Het
Olfr203 T A 16: 59,303,361 D69E probably damaging Het
Parpbp A G 10: 88,133,191 L131P probably damaging Het
Prl3a1 T C 13: 27,270,110 W24R probably damaging Het
Ptprk T A 10: 28,493,064 N677K probably damaging Het
Rbm39 A T 2: 156,162,873 D181E possibly damaging Het
Ros1 T C 10: 52,166,197 T220A possibly damaging Het
Slc46a3 T C 5: 147,886,211 I274V probably benign Het
Tas2r104 T A 6: 131,684,975 N257I probably damaging Het
Timeless A G 10: 128,244,244 probably null Het
Tmem63a T C 1: 180,972,833 probably null Het
Traf5 T C 1: 191,997,485 D535G possibly damaging Het
Trank1 C T 9: 111,365,860 S984L possibly damaging Het
Trpm6 A G 19: 18,856,175 T1573A probably benign Het
Ube3b T A 5: 114,412,299 I835N probably damaging Het
Wnt16 T A 6: 22,290,948 I125N probably damaging Het
Xirp2 G T 2: 67,476,785 probably benign Het
Zc3h12c G T 9: 52,116,682 T460K probably benign Het
Zfp651 T C 9: 121,767,339 F624S possibly damaging Het
Zfp865 C A 7: 5,030,417 T467K probably benign Het
Zim1 A G 7: 6,677,698 V322A possibly damaging Het
Other mutations in Lrch3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01129:Lrch3 APN 16 32994965 missense probably benign 0.10
IGL01400:Lrch3 APN 16 32979541 missense probably damaging 1.00
IGL02565:Lrch3 APN 16 33005714 missense probably benign 0.00
IGL03076:Lrch3 APN 16 32981853 missense possibly damaging 0.52
IGL03103:Lrch3 APN 16 32952137 missense probably damaging 1.00
IGL03125:Lrch3 APN 16 32914277 missense possibly damaging 0.83
IGL03349:Lrch3 APN 16 32955324 missense probably damaging 1.00
R0054:Lrch3 UTSW 16 32995852 intron probably benign
R0123:Lrch3 UTSW 16 32961754 splice site probably benign
R0225:Lrch3 UTSW 16 32961754 splice site probably benign
R0326:Lrch3 UTSW 16 32979500 missense probably damaging 1.00
R0455:Lrch3 UTSW 16 32986880 missense probably damaging 0.99
R0734:Lrch3 UTSW 16 32997483 nonsense probably null
R1204:Lrch3 UTSW 16 33009214 missense probably damaging 1.00
R1470:Lrch3 UTSW 16 32988495 splice site probably benign
R1526:Lrch3 UTSW 16 32950376 missense probably damaging 1.00
R1597:Lrch3 UTSW 16 32950411 nonsense probably null
R1850:Lrch3 UTSW 16 32986793 missense probably benign 0.01
R1966:Lrch3 UTSW 16 32914385 missense possibly damaging 0.94
R2241:Lrch3 UTSW 16 32995841 missense probably damaging 0.99
R2313:Lrch3 UTSW 16 32961675 missense probably damaging 1.00
R2902:Lrch3 UTSW 16 32950396 missense probably damaging 1.00
R4723:Lrch3 UTSW 16 32988484 splice site probably null
R4795:Lrch3 UTSW 16 33005704 missense probably damaging 1.00
R4970:Lrch3 UTSW 16 32998513 missense probably damaging 1.00
R5223:Lrch3 UTSW 16 32914397 missense probably damaging 0.99
R5292:Lrch3 UTSW 16 32975807 missense probably damaging 1.00
R5414:Lrch3 UTSW 16 32985965 unclassified probably null
R5470:Lrch3 UTSW 16 32998590 missense probably damaging 1.00
R5594:Lrch3 UTSW 16 32914184 missense probably damaging 0.99
R5862:Lrch3 UTSW 16 32995809 missense probably damaging 1.00
R5911:Lrch3 UTSW 16 32959463 missense probably damaging 1.00
R5932:Lrch3 UTSW 16 32975736 missense probably damaging 1.00
R6519:Lrch3 UTSW 16 32994997 critical splice donor site probably benign
R6731:Lrch3 UTSW 16 32950420 missense probably damaging 1.00
R7182:Lrch3 UTSW 16 32993779 missense probably benign 0.05
R7197:Lrch3 UTSW 16 32990295 missense probably damaging 1.00
R7319:Lrch3 UTSW 16 32994993 missense probably benign 0.19
R7392:Lrch3 UTSW 16 32986755 nonsense probably null
R7408:Lrch3 UTSW 16 32986743 nonsense probably null
R7414:Lrch3 UTSW 16 32998513 missense probably damaging 1.00
R7425:Lrch3 UTSW 16 33005707 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACTCTGAAGTTACTGACCTG -3'
(R):5'- GCACAATGACTCCACTGAGC -3'

Sequencing Primer
(F):5'- GAGACAAGGTCTTTATAGCCCTGC -3'
(R):5'- TGACTCCACTGAGCTGAAAC -3'
Posted On2016-12-20