Incidental Mutation 'R5843:Trpm6'
ID450565
Institutional Source Beutler Lab
Gene Symbol Trpm6
Ensembl Gene ENSMUSG00000024727
Gene Nametransient receptor potential cation channel, subfamily M, member 6
SynonymsCHAK2
MMRRC Submission 043224-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5843 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location18749983-18892510 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 18856175 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 1573 (T1573A)
Ref Sequence ENSEMBL: ENSMUSP00000037443 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040489]
Predicted Effect probably benign
Transcript: ENSMUST00000040489
AA Change: T1573A

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000037443
Gene: ENSMUSG00000024727
AA Change: T1573A

DomainStartEndE-ValueType
Blast:ANK 430 459 4e-8 BLAST
low complexity region 580 604 N/A INTRINSIC
transmembrane domain 749 766 N/A INTRINSIC
Pfam:Ion_trans 847 1087 2.8e-13 PFAM
low complexity region 1113 1126 N/A INTRINSIC
low complexity region 1136 1154 N/A INTRINSIC
Pfam:TRPM_tetra 1176 1231 7.5e-27 PFAM
low complexity region 1320 1331 N/A INTRINSIC
low complexity region 1578 1596 N/A INTRINSIC
Blast:Alpha_kinase 1618 1673 9e-11 BLAST
low complexity region 1682 1695 N/A INTRINSIC
Alpha_kinase 1761 1978 1e-84 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is predominantly expressed in the kidney and colon, and encodes a protein containing an ion channel domain and a protein kinase domain. It is crucial for magnesium homeostasis, and plays an essential role in epithelial magnesium transport and in the active magnesium absorption in the gut and kidney. Mutations in this gene are associated with hypomagnesemia with secondary hypocalcemia. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic and postnatal lethality with exencephaly, spina bifida occulta, and abnormal brain and facial development. Mice heterozygous for a knock-out allele exhibit some premature death and decreased serummagnesium. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agap1 A G 1: 89,609,550 T93A probably damaging Het
Atp6v1h T A 1: 5,162,089 probably null Het
Ccnk T C 12: 108,193,730 V157A probably damaging Het
Cdh10 T C 15: 18,985,200 F317L possibly damaging Het
Chn1 A G 2: 73,679,748 I139T probably benign Het
Creld2 A T 15: 88,826,429 D349V probably damaging Het
Dnah3 TTCCTC TTC 7: 119,951,021 probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Frem1 T C 4: 82,936,052 D1660G probably damaging Het
Hipk3 A C 2: 104,440,224 S470R possibly damaging Het
Hook2 T A 8: 84,991,283 I37K probably damaging Het
Hpcal1 T C 12: 17,791,199 F193L probably benign Het
Hps4 T C 5: 112,349,430 probably null Het
Iqgap1 T C 7: 80,726,080 N1349S probably benign Het
Khk A G 5: 30,921,931 I6V possibly damaging Het
Kmt2d G A 15: 98,852,109 probably benign Het
Lrch3 T C 16: 32,998,526 V629A probably damaging Het
Mtpn C T 6: 35,512,290 D100N probably benign Het
Muc13 A G 16: 33,806,051 Y320C probably damaging Het
Olfr10 A T 11: 49,318,249 R234S probably benign Het
Olfr169 T A 16: 19,566,583 Q100L probably damaging Het
Olfr203 T A 16: 59,303,361 D69E probably damaging Het
Parpbp A G 10: 88,133,191 L131P probably damaging Het
Prl3a1 T C 13: 27,270,110 W24R probably damaging Het
Ptprk T A 10: 28,493,064 N677K probably damaging Het
Rbm39 A T 2: 156,162,873 D181E possibly damaging Het
Ros1 T C 10: 52,166,197 T220A possibly damaging Het
Slc46a3 T C 5: 147,886,211 I274V probably benign Het
Tas2r104 T A 6: 131,684,975 N257I probably damaging Het
Timeless A G 10: 128,244,244 probably null Het
Tmem63a T C 1: 180,972,833 probably null Het
Traf5 T C 1: 191,997,485 D535G possibly damaging Het
Trank1 C T 9: 111,365,860 S984L possibly damaging Het
Ube3b T A 5: 114,412,299 I835N probably damaging Het
Wnt16 T A 6: 22,290,948 I125N probably damaging Het
Xirp2 G T 2: 67,476,785 probably benign Het
Zc3h12c G T 9: 52,116,682 T460K probably benign Het
Zfp651 T C 9: 121,767,339 F624S possibly damaging Het
Zfp865 C A 7: 5,030,417 T467K probably benign Het
Zim1 A G 7: 6,677,698 V322A possibly damaging Het
Other mutations in Trpm6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00540:Trpm6 APN 19 18783908 splice site probably benign
IGL00862:Trpm6 APN 19 18827528 missense probably damaging 1.00
IGL01348:Trpm6 APN 19 18877651 missense probably damaging 1.00
IGL01400:Trpm6 APN 19 18825794 nonsense probably null
IGL01451:Trpm6 APN 19 18809569 missense probably damaging 1.00
IGL01508:Trpm6 APN 19 18796530 nonsense probably null
IGL01995:Trpm6 APN 19 18830327 splice site probably benign
IGL02092:Trpm6 APN 19 18772331 missense possibly damaging 0.59
IGL02152:Trpm6 APN 19 18832539 missense possibly damaging 0.93
IGL02294:Trpm6 APN 19 18854063 missense probably benign
IGL02329:Trpm6 APN 19 18854217 missense probably benign 0.17
IGL02366:Trpm6 APN 19 18778510 splice site probably benign
IGL02402:Trpm6 APN 19 18786756 missense probably benign 0.18
IGL02457:Trpm6 APN 19 18825791 missense probably damaging 1.00
IGL02457:Trpm6 APN 19 18827398 nonsense probably null
IGL02684:Trpm6 APN 19 18802207 splice site probably benign
IGL02705:Trpm6 APN 19 18776733 critical splice donor site probably null
IGL02728:Trpm6 APN 19 18809652 missense possibly damaging 0.71
IGL02742:Trpm6 APN 19 18830012 splice site probably benign
IGL02818:Trpm6 APN 19 18866257 missense probably benign 0.04
IGL02836:Trpm6 APN 19 18813482 missense probably damaging 1.00
IGL03119:Trpm6 APN 19 18838017 nonsense probably null
IGL03193:Trpm6 APN 19 18825872 missense possibly damaging 0.94
IGL03227:Trpm6 APN 19 18819119 missense probably benign 0.01
IGL03227:Trpm6 APN 19 18786779 missense probably benign 0.12
IGL03231:Trpm6 APN 19 18819181 missense probably benign
IGL03245:Trpm6 APN 19 18877701 missense probably damaging 1.00
IGL03328:Trpm6 APN 19 18838082 missense possibly damaging 0.94
IGL03341:Trpm6 APN 19 18813486 missense probably benign
P0043:Trpm6 UTSW 19 18877765 missense probably damaging 1.00
R0057:Trpm6 UTSW 19 18786755 missense probably benign 0.05
R0115:Trpm6 UTSW 19 18829952 missense probably damaging 0.98
R0119:Trpm6 UTSW 19 18832593 missense probably benign 0.05
R0140:Trpm6 UTSW 19 18819194 splice site probably null
R0267:Trpm6 UTSW 19 18823378 missense probably benign
R0350:Trpm6 UTSW 19 18883957 splice site probably null
R0373:Trpm6 UTSW 19 18853587 missense probably benign 0.15
R0393:Trpm6 UTSW 19 18778644 missense probably damaging 0.99
R0416:Trpm6 UTSW 19 18783025 splice site probably benign
R0505:Trpm6 UTSW 19 18873902 splice site probably benign
R0526:Trpm6 UTSW 19 18792876 missense probably damaging 0.97
R0607:Trpm6 UTSW 19 18872221 missense probably benign 0.00
R0609:Trpm6 UTSW 19 18825862 missense probably damaging 0.97
R0714:Trpm6 UTSW 19 18838087 missense possibly damaging 0.90
R1215:Trpm6 UTSW 19 18796498 missense probably damaging 1.00
R1474:Trpm6 UTSW 19 18796495 missense probably benign 0.28
R1512:Trpm6 UTSW 19 18875931 missense probably benign
R1558:Trpm6 UTSW 19 18786828 missense probably benign 0.04
R1597:Trpm6 UTSW 19 18827524 missense probably damaging 0.98
R1618:Trpm6 UTSW 19 18877631 missense possibly damaging 0.88
R1779:Trpm6 UTSW 19 18856217 missense probably damaging 1.00
R1796:Trpm6 UTSW 19 18827567 missense possibly damaging 0.90
R1799:Trpm6 UTSW 19 18891999 splice site probably null
R1840:Trpm6 UTSW 19 18866267 missense probably benign 0.21
R1991:Trpm6 UTSW 19 18796284 missense probably benign 0.00
R2030:Trpm6 UTSW 19 18854265 missense probably benign
R2073:Trpm6 UTSW 19 18876042 missense probably damaging 1.00
R2074:Trpm6 UTSW 19 18877739 missense probably damaging 1.00
R2096:Trpm6 UTSW 19 18825752 missense probably damaging 0.97
R2103:Trpm6 UTSW 19 18796284 missense probably benign 0.00
R2106:Trpm6 UTSW 19 18813350 missense possibly damaging 0.95
R2117:Trpm6 UTSW 19 18829952 missense probably damaging 0.98
R2850:Trpm6 UTSW 19 18792090 missense possibly damaging 0.68
R3125:Trpm6 UTSW 19 18854431 missense probably benign 0.05
R3719:Trpm6 UTSW 19 18772393 nonsense probably null
R3779:Trpm6 UTSW 19 18876039 missense possibly damaging 0.80
R4115:Trpm6 UTSW 19 18832557 missense probably damaging 1.00
R4367:Trpm6 UTSW 19 18827525 missense probably damaging 0.99
R4523:Trpm6 UTSW 19 18796500 missense probably damaging 1.00
R4546:Trpm6 UTSW 19 18832477 missense probably damaging 1.00
R4564:Trpm6 UTSW 19 18832597 missense possibly damaging 0.95
R4565:Trpm6 UTSW 19 18825872 missense probably damaging 1.00
R4697:Trpm6 UTSW 19 18853791 missense probably benign 0.01
R4714:Trpm6 UTSW 19 18854200 missense possibly damaging 0.93
R4750:Trpm6 UTSW 19 18876064 missense probably damaging 0.99
R4771:Trpm6 UTSW 19 18813493 missense probably damaging 0.97
R4791:Trpm6 UTSW 19 18867981 missense probably benign 0.00
R4814:Trpm6 UTSW 19 18862212 missense probably benign 0.11
R5028:Trpm6 UTSW 19 18786760 missense probably damaging 1.00
R5237:Trpm6 UTSW 19 18813464 missense probably damaging 1.00
R5615:Trpm6 UTSW 19 18829933 missense probably damaging 0.96
R5642:Trpm6 UTSW 19 18830207 missense probably damaging 1.00
R5645:Trpm6 UTSW 19 18853604 missense probably damaging 1.00
R5726:Trpm6 UTSW 19 18853617 missense probably damaging 1.00
R5832:Trpm6 UTSW 19 18786819 missense possibly damaging 0.66
R5955:Trpm6 UTSW 19 18892019 missense possibly damaging 0.75
R6101:Trpm6 UTSW 19 18853748 nonsense probably null
R6105:Trpm6 UTSW 19 18853748 nonsense probably null
R6211:Trpm6 UTSW 19 18783128 missense probably damaging 1.00
R6228:Trpm6 UTSW 19 18854291 missense probably damaging 1.00
R6263:Trpm6 UTSW 19 18854108 missense possibly damaging 0.94
R6453:Trpm6 UTSW 19 18829990 missense probably damaging 1.00
R6562:Trpm6 UTSW 19 18838042 missense probably damaging 1.00
R6624:Trpm6 UTSW 19 18796439 critical splice acceptor site probably null
R6624:Trpm6 UTSW 19 18889020 missense probably damaging 1.00
R6729:Trpm6 UTSW 19 18830297 missense probably damaging 1.00
R6765:Trpm6 UTSW 19 18877765 missense probably damaging 1.00
R6976:Trpm6 UTSW 19 18783163 missense probably benign
Predicted Primers PCR Primer
(F):5'- CAGTCTCCATGAGGATGCTC -3'
(R):5'- TTCACTCCTCCTGGTACAAGGC -3'

Sequencing Primer
(F):5'- TCCATGAGGATGCTCCCCAC -3'
(R):5'- TACAAGGCTCTCAAGTGTGC -3'
Posted On2016-12-20