Incidental Mutation 'R5844:Mfsd6'
ID450569
Institutional Source Beutler Lab
Gene Symbol Mfsd6
Ensembl Gene ENSMUSG00000041439
Gene Namemajor facilitator superfamily domain containing 6
SynonymsMMR2, 9630025I22Rik, 2210010L05Rik
MMRRC Submission 044062-MU
Accession Numbers

Ncbi RefSeq: NM_133829.2, NM_178081.4; MGI:1922925

Is this an essential gene? Probably non essential (E-score: 0.142) question?
Stock #R5844 (G1)
Quality Score140
Status Validated
Chromosome1
Chromosomal Location52656286-52727462 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 52658383 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 782 (S782G)
Ref Sequence ENSEMBL: ENSMUSP00000122881 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087701] [ENSMUST00000156876]
Predicted Effect probably benign
Transcript: ENSMUST00000087701
SMART Domains Protein: ENSMUSP00000084991
Gene: ENSMUSG00000041439

DomainStartEndE-ValueType
low complexity region 33 48 N/A INTRINSIC
Pfam:MFS_1_like 68 144 4.8e-19 PFAM
Pfam:MFS_1 70 162 7e-11 PFAM
Pfam:MFS_2 72 571 3.8e-13 PFAM
Pfam:Nuc_H_symport 424 628 1.1e-11 PFAM
Pfam:MFS_1 453 708 6.3e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147758
SMART Domains Protein: ENSMUSP00000115398
Gene: ENSMUSG00000041439

DomainStartEndE-ValueType
low complexity region 89 101 N/A INTRINSIC
transmembrane domain 120 142 N/A INTRINSIC
transmembrane domain 163 185 N/A INTRINSIC
transmembrane domain 200 219 N/A INTRINSIC
Pfam:Nuc_H_symport 255 459 1.4e-11 PFAM
Pfam:MFS_1 284 539 6.8e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149887
Predicted Effect probably benign
Transcript: ENSMUST00000156876
AA Change: S782G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000122881
Gene: ENSMUSG00000041439
AA Change: S782G

DomainStartEndE-ValueType
low complexity region 33 48 N/A INTRINSIC
Pfam:MFS_1_like 68 144 6.2e-20 PFAM
Pfam:MFS_1 70 162 1.8e-10 PFAM
low complexity region 258 270 N/A INTRINSIC
transmembrane domain 289 311 N/A INTRINSIC
transmembrane domain 332 354 N/A INTRINSIC
transmembrane domain 369 388 N/A INTRINSIC
Pfam:Nuc_H_symport 424 628 2.6e-11 PFAM
Pfam:MFS_1 453 707 1.7e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188126
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191873
Meta Mutation Damage Score 0.216 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 98% (55/56)
Allele List at MGI

All alleles(4) : Targeted(4)

Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik A T 15: 82,065,864 M1321L probably benign Het
Adra1a C T 14: 66,727,734 T391I probably benign Het
Atf7ip C A 6: 136,606,814 A1281D probably damaging Het
BC005624 T C 2: 30,976,011 N141S probably benign Het
Catsperg2 A T 7: 29,697,832 L1082Q possibly damaging Het
Cavin2 C T 1: 51,289,839 R152C probably damaging Het
Ccdc33 C T 9: 58,033,206 probably benign Het
Cfap43 T C 19: 47,795,696 D466G probably benign Het
Cfap46 C A 7: 139,650,942 M923I probably damaging Het
Chd1l T A 3: 97,572,567 K621N probably benign Het
Cnksr1 A G 4: 134,228,264 probably benign Het
Cym T C 3: 107,219,764 H25R probably benign Het
Dagla T A 19: 10,271,125 D57V probably damaging Het
Dnah3 TTCCTC TTC 7: 119,951,021 probably benign Het
Dse T A 10: 34,153,042 D684V probably damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fbxo10 A T 4: 45,058,760 S326T probably benign Het
Galntl5 G T 5: 25,186,093 probably benign Het
Grm5 A G 7: 87,804,024 R290G possibly damaging Het
Gtpbp3 A G 8: 71,492,555 T425A probably benign Het
Hepacam2 A G 6: 3,476,073 I284T probably damaging Het
Ifi205 A C 1: 174,026,692 probably null Het
Irs3 T C 5: 137,644,286 T297A probably benign Het
Kmt2d G A 15: 98,852,109 probably benign Het
Map4k4 T A 1: 39,999,876 probably benign Het
Mis18a G A 16: 90,727,081 silent Het
Mtpn C T 6: 35,512,290 D100N probably benign Het
Myom2 G A 8: 15,131,182 probably null Het
Olfr1002 A G 2: 85,647,895 V142A probably benign Het
Olfr211 A T 6: 116,493,939 E110V probably damaging Het
Pde3b C T 7: 114,508,871 T568I probably benign Het
Pkhd1 G T 1: 20,381,461 D2203E probably benign Het
Ppp1r36 A G 12: 76,426,792 K66E possibly damaging Het
Rfc1 C A 5: 65,293,787 M319I probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Runx1t1 T C 4: 13,881,068 V456A probably damaging Het
Rxfp2 A G 5: 150,043,124 K109R probably benign Het
Sgo2a T G 1: 58,016,397 V580G probably damaging Het
Skint9 T C 4: 112,413,883 Q110R probably benign Het
Slc38a9 A G 13: 112,731,501 Y507C probably damaging Het
Smarca4 T A 9: 21,677,942 probably benign Het
Tmem55b T C 14: 50,929,042 T160A probably benign Het
Tmem88 C G 11: 69,397,678 Q138H probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tns3 A C 11: 8,434,580 F1413V probably damaging Het
Trpm8 T C 1: 88,384,711 *1105Q probably null Het
Wdyhv1 A G 15: 58,153,660 N157S probably benign Het
Zfp853 C T 5: 143,288,669 V399M unknown Het
Zim1 T C 7: 6,678,116 R183G probably benign Het
Zmiz1 T C 14: 25,656,930 S871P probably damaging Het
Other mutations in Mfsd6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00490:Mfsd6 APN 1 52708254 missense probably damaging 1.00
IGL00820:Mfsd6 APN 1 52708306 missense probably damaging 1.00
IGL01518:Mfsd6 APN 1 52709322 missense probably damaging 1.00
IGL02111:Mfsd6 APN 1 52708344 missense probably damaging 1.00
IGL02517:Mfsd6 APN 1 52663277 splice site probably benign
IGL02687:Mfsd6 APN 1 52708675 missense probably damaging 0.99
IGL02887:Mfsd6 APN 1 52708878 missense probably benign 0.19
IGL02901:Mfsd6 APN 1 52708473 missense probably benign 0.07
IGL03030:Mfsd6 APN 1 52709703 start codon destroyed probably null 1.00
PIT4280001:Mfsd6 UTSW 1 52660880 missense probably benign 0.00
PIT4466001:Mfsd6 UTSW 1 52708897 missense probably benign 0.03
R0043:Mfsd6 UTSW 1 52708652 nonsense probably null
R0113:Mfsd6 UTSW 1 52709189 missense probably damaging 1.00
R0226:Mfsd6 UTSW 1 52658690 intron probably benign
R0302:Mfsd6 UTSW 1 52709457 missense probably damaging 1.00
R0613:Mfsd6 UTSW 1 52658696 intron probably benign
R1126:Mfsd6 UTSW 1 52709511 missense probably benign 0.16
R1368:Mfsd6 UTSW 1 52708605 missense possibly damaging 0.49
R1471:Mfsd6 UTSW 1 52709557 missense probably benign 0.32
R1733:Mfsd6 UTSW 1 52709365 missense probably damaging 1.00
R1768:Mfsd6 UTSW 1 52660805 critical splice donor site probably null
R1951:Mfsd6 UTSW 1 52709358 missense probably damaging 1.00
R2031:Mfsd6 UTSW 1 52708854 missense probably benign 0.04
R2116:Mfsd6 UTSW 1 52660975 missense probably benign 0.21
R2240:Mfsd6 UTSW 1 52660819 missense probably damaging 0.97
R2242:Mfsd6 UTSW 1 52709598 missense probably benign 0.03
R2303:Mfsd6 UTSW 1 52676513 missense probably damaging 0.98
R2382:Mfsd6 UTSW 1 52708410 missense probably benign 0.10
R4568:Mfsd6 UTSW 1 52663289 nonsense probably null
R4801:Mfsd6 UTSW 1 52709596 missense probably benign 0.08
R4802:Mfsd6 UTSW 1 52709596 missense probably benign 0.08
R4958:Mfsd6 UTSW 1 52661024 missense probably damaging 1.00
R5134:Mfsd6 UTSW 1 52708356 missense possibly damaging 0.80
R5827:Mfsd6 UTSW 1 52662392 missense probably damaging 1.00
R6124:Mfsd6 UTSW 1 52708252 missense probably damaging 1.00
R6435:Mfsd6 UTSW 1 52709444 nonsense probably null
R6515:Mfsd6 UTSW 1 52660961 missense probably damaging 1.00
R6874:Mfsd6 UTSW 1 52660709 missense probably benign 0.02
R6878:Mfsd6 UTSW 1 52708753 missense probably damaging 0.98
R7111:Mfsd6 UTSW 1 52709758 splice site probably null
R7170:Mfsd6 UTSW 1 52662388 critical splice donor site probably null
R7242:Mfsd6 UTSW 1 52709474 missense probably damaging 0.98
R7548:Mfsd6 UTSW 1 52663287 missense not run
Predicted Primers PCR Primer
(F):5'- GCATTTGTGCATCTGCGTGC -3'
(R):5'- ATGCGTTGGTCCCTGAAGTG -3'

Sequencing Primer
(F):5'- TGTTGTTCCACAGTAATGAGTTTAG -3'
(R):5'- CAGCATCTCAAACGCAGT -3'
Posted On2016-12-20