Incidental Mutation 'R5844:BC005624'
ID450573
Institutional Source Beutler Lab
Gene Symbol BC005624
Ensembl Gene ENSMUSG00000026851
Gene NamecDNA sequence BC005624
Synonyms
MMRRC Submission 044062-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.891) question?
Stock #R5844 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location30972177-30982201 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 30976011 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 141 (N141S)
Ref Sequence ENSEMBL: ENSMUSP00000028205 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028205]
Predicted Effect probably benign
Transcript: ENSMUST00000028205
AA Change: N141S

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000028205
Gene: ENSMUSG00000026851
AA Change: N141S

DomainStartEndE-ValueType
coiled coil region 10 37 N/A INTRINSIC
Pfam:Hep_59 101 197 3e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152007
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156325
Meta Mutation Damage Score 0.07 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 98% (55/56)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik A T 15: 82,065,864 M1321L probably benign Het
Adra1a C T 14: 66,727,734 T391I probably benign Het
Atf7ip C A 6: 136,606,814 A1281D probably damaging Het
Catsperg2 A T 7: 29,697,832 L1082Q possibly damaging Het
Cavin2 C T 1: 51,289,839 R152C probably damaging Het
Ccdc33 C T 9: 58,033,206 probably benign Het
Cfap43 T C 19: 47,795,696 D466G probably benign Het
Cfap46 C A 7: 139,650,942 M923I probably damaging Het
Chd1l T A 3: 97,572,567 K621N probably benign Het
Cnksr1 A G 4: 134,228,264 probably benign Het
Cym T C 3: 107,219,764 H25R probably benign Het
Dagla T A 19: 10,271,125 D57V probably damaging Het
Dnah3 TTCCTC TTC 7: 119,951,021 probably benign Het
Dse T A 10: 34,153,042 D684V probably damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fbxo10 A T 4: 45,058,760 S326T probably benign Het
Galntl5 G T 5: 25,186,093 probably benign Het
Grm5 A G 7: 87,804,024 R290G possibly damaging Het
Gtpbp3 A G 8: 71,492,555 T425A probably benign Het
Hepacam2 A G 6: 3,476,073 I284T probably damaging Het
Ifi205 A C 1: 174,026,692 probably null Het
Irs3 T C 5: 137,644,286 T297A probably benign Het
Kmt2d G A 15: 98,852,109 probably benign Het
Map4k4 T A 1: 39,999,876 probably benign Het
Mfsd6 T C 1: 52,658,383 S782G probably benign Het
Mis18a G A 16: 90,727,081 silent Het
Mtpn C T 6: 35,512,290 D100N probably benign Het
Myom2 G A 8: 15,131,182 probably null Het
Olfr1002 A G 2: 85,647,895 V142A probably benign Het
Olfr211 A T 6: 116,493,939 E110V probably damaging Het
Pde3b C T 7: 114,508,871 T568I probably benign Het
Pkhd1 G T 1: 20,381,461 D2203E probably benign Het
Ppp1r36 A G 12: 76,426,792 K66E possibly damaging Het
Rfc1 C A 5: 65,293,787 M319I probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Runx1t1 T C 4: 13,881,068 V456A probably damaging Het
Rxfp2 A G 5: 150,043,124 K109R probably benign Het
Sgo2a T G 1: 58,016,397 V580G probably damaging Het
Skint9 T C 4: 112,413,883 Q110R probably benign Het
Slc38a9 A G 13: 112,731,501 Y507C probably damaging Het
Smarca4 T A 9: 21,677,942 probably benign Het
Tmem55b T C 14: 50,929,042 T160A probably benign Het
Tmem88 C G 11: 69,397,678 Q138H probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tns3 A C 11: 8,434,580 F1413V probably damaging Het
Trpm8 T C 1: 88,384,711 *1105Q probably null Het
Wdyhv1 A G 15: 58,153,660 N157S probably benign Het
Zfp853 C T 5: 143,288,669 V399M unknown Het
Zim1 T C 7: 6,678,116 R183G probably benign Het
Zmiz1 T C 14: 25,656,930 S871P probably damaging Het
Other mutations in BC005624
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02063:BC005624 APN 2 30978934 missense probably benign 0.37
IGL02350:BC005624 APN 2 30973767 missense probably benign 0.22
IGL02357:BC005624 APN 2 30973767 missense probably benign 0.22
IGL02887:BC005624 APN 2 30973305 splice site probably benign
R0401:BC005624 UTSW 2 30980009 missense probably benign 0.12
R0732:BC005624 UTSW 2 30973937 missense possibly damaging 0.87
R1629:BC005624 UTSW 2 30974008 missense probably damaging 1.00
R1706:BC005624 UTSW 2 30978910 missense possibly damaging 0.63
R1712:BC005624 UTSW 2 30974008 missense probably damaging 1.00
R5840:BC005624 UTSW 2 30981857 missense probably benign 0.01
R6932:BC005624 UTSW 2 30978928 missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- ACTGAAACCCTGTCAGCTCTTC -3'
(R):5'- TCCTTTAAAGGGTAAGGCACAC -3'

Sequencing Primer
(F):5'- TGTCAGCTCTTCCCGAGG -3'
(R):5'- GGTAAAGATGTCTTCTGCCAGCC -3'
Posted On2016-12-20