Incidental Mutation 'R5844:Olfr211'
ID450589
Institutional Source Beutler Lab
Gene Symbol Olfr211
Ensembl Gene ENSMUSG00000053391
Gene Nameolfactory receptor 211
SynonymsGA_x54KRFPKN04-58127726-58128655, MOR253-9
MMRRC Submission 044062-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.833) question?
Stock #R5844 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location116489091-116498221 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 116493939 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 110 (E110V)
Ref Sequence ENSEMBL: ENSMUSP00000145330 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065786] [ENSMUST00000203700]
Predicted Effect probably damaging
Transcript: ENSMUST00000065786
AA Change: E110V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000066524
Gene: ENSMUSG00000053391
AA Change: E110V

DomainStartEndE-ValueType
Pfam:7tm_4 28 306 6.2e-49 PFAM
Pfam:7TM_GPCR_Srsx 34 304 3.4e-6 PFAM
Pfam:7tm_1 40 289 4e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000203700
AA Change: E110V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000145330
Gene: ENSMUSG00000053391
AA Change: E110V

DomainStartEndE-ValueType
Pfam:7tm_4 28 306 6.2e-49 PFAM
Pfam:7TM_GPCR_Srsx 34 304 3.4e-6 PFAM
Pfam:7tm_1 40 289 4e-24 PFAM
Meta Mutation Damage Score 0.27 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik A T 15: 82,065,864 M1321L probably benign Het
Adra1a C T 14: 66,727,734 T391I probably benign Het
Atf7ip C A 6: 136,606,814 A1281D probably damaging Het
BC005624 T C 2: 30,976,011 N141S probably benign Het
Catsperg2 A T 7: 29,697,832 L1082Q possibly damaging Het
Cavin2 C T 1: 51,289,839 R152C probably damaging Het
Ccdc33 C T 9: 58,033,206 probably benign Het
Cfap43 T C 19: 47,795,696 D466G probably benign Het
Cfap46 C A 7: 139,650,942 M923I probably damaging Het
Chd1l T A 3: 97,572,567 K621N probably benign Het
Cnksr1 A G 4: 134,228,264 probably benign Het
Cym T C 3: 107,219,764 H25R probably benign Het
Dagla T A 19: 10,271,125 D57V probably damaging Het
Dnah3 TTCCTC TTC 7: 119,951,021 probably benign Het
Dse T A 10: 34,153,042 D684V probably damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fbxo10 A T 4: 45,058,760 S326T probably benign Het
Galntl5 G T 5: 25,186,093 probably benign Het
Grm5 A G 7: 87,804,024 R290G possibly damaging Het
Gtpbp3 A G 8: 71,492,555 T425A probably benign Het
Hepacam2 A G 6: 3,476,073 I284T probably damaging Het
Ifi205 A C 1: 174,026,692 probably null Het
Irs3 T C 5: 137,644,286 T297A probably benign Het
Kmt2d G A 15: 98,852,109 probably benign Het
Map4k4 T A 1: 39,999,876 probably benign Het
Mfsd6 T C 1: 52,658,383 S782G probably benign Het
Mis18a G A 16: 90,727,081 silent Het
Mtpn C T 6: 35,512,290 D100N probably benign Het
Myom2 G A 8: 15,131,182 probably null Het
Olfr1002 A G 2: 85,647,895 V142A probably benign Het
Pde3b C T 7: 114,508,871 T568I probably benign Het
Pkhd1 G T 1: 20,381,461 D2203E probably benign Het
Ppp1r36 A G 12: 76,426,792 K66E possibly damaging Het
Rfc1 C A 5: 65,293,787 M319I probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Runx1t1 T C 4: 13,881,068 V456A probably damaging Het
Rxfp2 A G 5: 150,043,124 K109R probably benign Het
Sgo2a T G 1: 58,016,397 V580G probably damaging Het
Skint9 T C 4: 112,413,883 Q110R probably benign Het
Slc38a9 A G 13: 112,731,501 Y507C probably damaging Het
Smarca4 T A 9: 21,677,942 probably benign Het
Tmem55b T C 14: 50,929,042 T160A probably benign Het
Tmem88 C G 11: 69,397,678 Q138H probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tns3 A C 11: 8,434,580 F1413V probably damaging Het
Trpm8 T C 1: 88,384,711 *1105Q probably null Het
Wdyhv1 A G 15: 58,153,660 N157S probably benign Het
Zfp853 C T 5: 143,288,669 V399M unknown Het
Zim1 T C 7: 6,678,116 R183G probably benign Het
Zmiz1 T C 14: 25,656,930 S871P probably damaging Het
Other mutations in Olfr211
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0681:Olfr211 UTSW 6 116494400 missense probably damaging 1.00
R1443:Olfr211 UTSW 6 116494425 missense probably benign 0.08
R1502:Olfr211 UTSW 6 116494281 missense probably damaging 1.00
R1962:Olfr211 UTSW 6 116493764 missense probably benign
R2421:Olfr211 UTSW 6 116493713 missense probably benign
R5151:Olfr211 UTSW 6 116493804 nonsense probably null
R7169:Olfr211 UTSW 6 116494064 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGGCCCTCACAGGTAATGTC -3'
(R):5'- TGTGTAATGACATTGGGCCCAC -3'

Sequencing Primer
(F):5'- CACAGGTAATGTCCTTATCATCTTGG -3'
(R):5'- TTGGGCCCACAGAAGCTCAAG -3'
Posted On2016-12-20