Incidental Mutation 'R5844:Cfap46'
ID450597
Institutional Source Beutler Lab
Gene Symbol Cfap46
Ensembl Gene ENSMUSG00000049571
Gene Namecilia and flagella associated protein 46
Synonyms9330101J02Rik
MMRRC Submission 044062-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5844 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location139600951-139683817 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 139650942 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 923 (M923I)
Ref Sequence ENSEMBL: ENSMUSP00000120186 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000129990] [ENSMUST00000140820] [ENSMUST00000155075]
Predicted Effect probably damaging
Transcript: ENSMUST00000129990
AA Change: M923I

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000120186
Gene: ENSMUSG00000049571
AA Change: M923I

DomainStartEndE-ValueType
Blast:TPR 175 207 7e-11 BLAST
Blast:TPR 426 459 1e-11 BLAST
low complexity region 868 879 N/A INTRINSIC
Blast:TPR 936 969 2e-7 BLAST
Blast:TPR 1112 1145 1e-9 BLAST
coiled coil region 1347 1423 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140820
SMART Domains Protein: ENSMUSP00000121085
Gene: ENSMUSG00000049571

DomainStartEndE-ValueType
Blast:TPR 175 208 5e-11 BLAST
Blast:TPR 426 459 8e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000155075
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156116
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 98% (55/56)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik A T 15: 82,065,864 M1321L probably benign Het
Adra1a C T 14: 66,727,734 T391I probably benign Het
Atf7ip C A 6: 136,606,814 A1281D probably damaging Het
BC005624 T C 2: 30,976,011 N141S probably benign Het
Catsperg2 A T 7: 29,697,832 L1082Q possibly damaging Het
Cavin2 C T 1: 51,289,839 R152C probably damaging Het
Ccdc33 C T 9: 58,033,206 probably benign Het
Cfap43 T C 19: 47,795,696 D466G probably benign Het
Chd1l T A 3: 97,572,567 K621N probably benign Het
Cnksr1 A G 4: 134,228,264 probably benign Het
Cym T C 3: 107,219,764 H25R probably benign Het
Dagla T A 19: 10,271,125 D57V probably damaging Het
Dnah3 TTCCTC TTC 7: 119,951,021 probably benign Het
Dse T A 10: 34,153,042 D684V probably damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fbxo10 A T 4: 45,058,760 S326T probably benign Het
Galntl5 G T 5: 25,186,093 probably benign Het
Grm5 A G 7: 87,804,024 R290G possibly damaging Het
Gtpbp3 A G 8: 71,492,555 T425A probably benign Het
Hepacam2 A G 6: 3,476,073 I284T probably damaging Het
Ifi205 A C 1: 174,026,692 probably null Het
Irs3 T C 5: 137,644,286 T297A probably benign Het
Kmt2d G A 15: 98,852,109 probably benign Het
Map4k4 T A 1: 39,999,876 probably benign Het
Mfsd6 T C 1: 52,658,383 S782G probably benign Het
Mis18a G A 16: 90,727,081 silent Het
Mtpn C T 6: 35,512,290 D100N probably benign Het
Myom2 G A 8: 15,131,182 probably null Het
Olfr1002 A G 2: 85,647,895 V142A probably benign Het
Olfr211 A T 6: 116,493,939 E110V probably damaging Het
Pde3b C T 7: 114,508,871 T568I probably benign Het
Pkhd1 G T 1: 20,381,461 D2203E probably benign Het
Ppp1r36 A G 12: 76,426,792 K66E possibly damaging Het
Rfc1 C A 5: 65,293,787 M319I probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Runx1t1 T C 4: 13,881,068 V456A probably damaging Het
Rxfp2 A G 5: 150,043,124 K109R probably benign Het
Sgo2a T G 1: 58,016,397 V580G probably damaging Het
Skint9 T C 4: 112,413,883 Q110R probably benign Het
Slc38a9 A G 13: 112,731,501 Y507C probably damaging Het
Smarca4 T A 9: 21,677,942 probably benign Het
Tmem55b T C 14: 50,929,042 T160A probably benign Het
Tmem88 C G 11: 69,397,678 Q138H probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tns3 A C 11: 8,434,580 F1413V probably damaging Het
Trpm8 T C 1: 88,384,711 *1105Q probably null Het
Wdyhv1 A G 15: 58,153,660 N157S probably benign Het
Zfp853 C T 5: 143,288,669 V399M unknown Het
Zim1 T C 7: 6,678,116 R183G probably benign Het
Zmiz1 T C 14: 25,656,930 S871P probably damaging Het
Other mutations in Cfap46
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00480:Cfap46 APN 7 139660689 missense probably damaging 0.96
IGL00493:Cfap46 APN 7 139614443 missense probably benign 0.06
IGL00505:Cfap46 APN 7 139660689 missense probably damaging 0.96
IGL00508:Cfap46 APN 7 139660689 missense probably damaging 0.96
IGL00514:Cfap46 APN 7 139660689 missense probably damaging 0.96
IGL01394:Cfap46 APN 7 139666979 missense probably damaging 1.00
IGL01621:Cfap46 APN 7 139606607 missense unknown
IGL02171:Cfap46 APN 7 139667056 missense possibly damaging 0.86
IGL02343:Cfap46 APN 7 139682509 missense probably damaging 0.99
IGL02679:Cfap46 APN 7 139614470 missense probably damaging 0.99
IGL02687:Cfap46 APN 7 139607201 missense probably damaging 0.99
IGL03180:Cfap46 APN 7 139603252 missense unknown
IGL03329:Cfap46 APN 7 139601165 missense probably damaging 0.99
FR4449:Cfap46 UTSW 7 139638795 utr 3 prime probably benign
FR4737:Cfap46 UTSW 7 139638930 utr 3 prime probably benign
FR4976:Cfap46 UTSW 7 139638930 utr 3 prime probably benign
PIT4651001:Cfap46 UTSW 7 139645551 missense
R0051:Cfap46 UTSW 7 139676035 missense probably damaging 1.00
R0051:Cfap46 UTSW 7 139676035 missense probably damaging 1.00
R0318:Cfap46 UTSW 7 139654566 missense probably damaging 1.00
R0358:Cfap46 UTSW 7 139651533 splice site probably benign
R0650:Cfap46 UTSW 7 139605655 missense unknown
R0675:Cfap46 UTSW 7 139676034 missense probably damaging 1.00
R0750:Cfap46 UTSW 7 139654670 missense probably damaging 1.00
R0931:Cfap46 UTSW 7 139655841 missense probably damaging 1.00
R1024:Cfap46 UTSW 7 139642597 missense probably benign 0.42
R1251:Cfap46 UTSW 7 139601265 missense probably benign 0.40
R1257:Cfap46 UTSW 7 139654629 nonsense probably null
R1538:Cfap46 UTSW 7 139683008 missense probably null 1.00
R1618:Cfap46 UTSW 7 139652810 missense probably benign 0.04
R1655:Cfap46 UTSW 7 139642520 nonsense probably null
R1824:Cfap46 UTSW 7 139639602 missense probably benign 0.12
R1830:Cfap46 UTSW 7 139640407 missense possibly damaging 0.92
R1857:Cfap46 UTSW 7 139653408 missense probably damaging 1.00
R1870:Cfap46 UTSW 7 139683470 missense probably damaging 1.00
R1945:Cfap46 UTSW 7 139679903 missense probably damaging 1.00
R1962:Cfap46 UTSW 7 139667041 missense probably damaging 1.00
R2108:Cfap46 UTSW 7 139683761 missense probably benign 0.03
R2354:Cfap46 UTSW 7 139661046 missense probably damaging 0.99
R2367:Cfap46 UTSW 7 139653498 missense probably damaging 0.99
R3237:Cfap46 UTSW 7 139617590 missense probably damaging 1.00
R3617:Cfap46 UTSW 7 139639599 missense probably benign 0.06
R3949:Cfap46 UTSW 7 139678551 missense probably benign 0.12
R4239:Cfap46 UTSW 7 139666287 missense possibly damaging 0.74
R4240:Cfap46 UTSW 7 139666287 missense possibly damaging 0.74
R4297:Cfap46 UTSW 7 139652673 missense probably benign 0.27
R4365:Cfap46 UTSW 7 139650952 missense probably damaging 0.99
R4516:Cfap46 UTSW 7 139660082 intron probably benign
R4595:Cfap46 UTSW 7 139652404 missense possibly damaging 0.74
R4627:Cfap46 UTSW 7 139657281 missense probably damaging 0.99
R4627:Cfap46 UTSW 7 139680927 missense probably damaging 1.00
R4628:Cfap46 UTSW 7 139680927 missense probably damaging 1.00
R4629:Cfap46 UTSW 7 139680927 missense probably damaging 1.00
R4687:Cfap46 UTSW 7 139627456 missense possibly damaging 0.79
R4750:Cfap46 UTSW 7 139679323 critical splice donor site probably null
R4771:Cfap46 UTSW 7 139630608 missense probably null
R4779:Cfap46 UTSW 7 139659815 intron probably benign
R4812:Cfap46 UTSW 7 139636000 missense probably damaging 1.00
R4974:Cfap46 UTSW 7 139607188 critical splice donor site probably null
R5014:Cfap46 UTSW 7 139627375 missense probably benign 0.12
R5033:Cfap46 UTSW 7 139603860 missense probably benign 0.00
R5055:Cfap46 UTSW 7 139661190 missense probably damaging 1.00
R5254:Cfap46 UTSW 7 139678514 missense possibly damaging 0.77
R5288:Cfap46 UTSW 7 139613507 critical splice donor site probably null
R5366:Cfap46 UTSW 7 139650886 missense probably damaging 1.00
R5368:Cfap46 UTSW 7 139627473 missense possibly damaging 0.77
R5371:Cfap46 UTSW 7 139632181 splice site probably null
R5642:Cfap46 UTSW 7 139678577 missense probably damaging 1.00
R5690:Cfap46 UTSW 7 139638353 missense probably benign 0.01
R5691:Cfap46 UTSW 7 139606700 missense possibly damaging 0.49
R5696:Cfap46 UTSW 7 139612031 missense probably damaging 1.00
R5963:Cfap46 UTSW 7 139651595 missense probably damaging 0.97
R6217:Cfap46 UTSW 7 139638900 utr 3 prime probably benign
R6228:Cfap46 UTSW 7 139656580 missense probably damaging 1.00
R6251:Cfap46 UTSW 7 139638900 utr 3 prime probably benign
R6253:Cfap46 UTSW 7 139638900 utr 3 prime probably benign
R6285:Cfap46 UTSW 7 139661085 missense probably damaging 1.00
R6334:Cfap46 UTSW 7 139680831 missense probably damaging 1.00
R6520:Cfap46 UTSW 7 139614405 critical splice donor site probably null
R6736:Cfap46 UTSW 7 139619971 missense possibly damaging 0.92
R6760:Cfap46 UTSW 7 139652440 missense probably damaging 1.00
R6773:Cfap46 UTSW 7 139642561 utr 3 prime probably benign
R6835:Cfap46 UTSW 7 139652498 missense probably damaging 0.98
R6903:Cfap46 UTSW 7 139654561 critical splice donor site probably null
R6912:Cfap46 UTSW 7 139639700 missense probably benign 0.09
R7163:Cfap46 UTSW 7 139618078 critical splice donor site probably null
R7232:Cfap46 UTSW 7 139617577 missense unknown
R7336:Cfap46 UTSW 7 139620104 missense unknown
R7337:Cfap46 UTSW 7 139630576 critical splice donor site probably null
R7437:Cfap46 UTSW 7 139650837 nonsense probably null
R7450:Cfap46 UTSW 7 139617437 missense unknown
R7495:Cfap46 UTSW 7 139603196 critical splice donor site probably null
W0251:Cfap46 UTSW 7 139603946 missense probably benign 0.11
X0018:Cfap46 UTSW 7 139680912 missense probably benign 0.03
X0064:Cfap46 UTSW 7 139603447 missense probably benign 0.01
Z1088:Cfap46 UTSW 7 139635064 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TACTGTGTGCCTCTAGGACATC -3'
(R):5'- GACTTCACAGATGGGTGTGG -3'

Sequencing Primer
(F):5'- CTCTAGGACATCATCGTGGAAGTC -3'
(R):5'- GTGGTCTATCTAGAACTGCATAGC -3'
Posted On2016-12-20