Incidental Mutation 'R5844:Tmem88'
ID450604
Institutional Source Beutler Lab
Gene Symbol Tmem88
Ensembl Gene ENSMUSG00000045377
Gene Nametransmembrane protein 88
Synonyms
MMRRC Submission 044062-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.143) question?
Stock #R5844 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location69396519-69398234 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 69397678 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Histidine at position 138 (Q138H)
Ref Sequence ENSEMBL: ENSMUSP00000055528 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050140] [ENSMUST00000051620] [ENSMUST00000094077] [ENSMUST00000108660] [ENSMUST00000144531]
Predicted Effect probably benign
Transcript: ENSMUST00000050140
AA Change: Q138H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000055528
Gene: ENSMUSG00000045377
AA Change: Q138H

DomainStartEndE-ValueType
transmembrane domain 44 66 N/A INTRINSIC
transmembrane domain 86 108 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000051620
SMART Domains Protein: ENSMUSP00000059709
Gene: ENSMUSG00000044795

DomainStartEndE-ValueType
Cyt-b5 20 92 1.89e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082283
Predicted Effect probably benign
Transcript: ENSMUST00000094077
SMART Domains Protein: ENSMUSP00000091620
Gene: ENSMUSG00000018476

DomainStartEndE-ValueType
low complexity region 29 43 N/A INTRINSIC
low complexity region 54 71 N/A INTRINSIC
SCOP:d1elwa_ 91 152 9e-5 SMART
low complexity region 214 227 N/A INTRINSIC
low complexity region 239 270 N/A INTRINSIC
low complexity region 312 329 N/A INTRINSIC
low complexity region 333 345 N/A INTRINSIC
low complexity region 389 415 N/A INTRINSIC
low complexity region 461 487 N/A INTRINSIC
low complexity region 515 524 N/A INTRINSIC
low complexity region 544 577 N/A INTRINSIC
low complexity region 585 615 N/A INTRINSIC
low complexity region 643 650 N/A INTRINSIC
low complexity region 711 719 N/A INTRINSIC
low complexity region 743 766 N/A INTRINSIC
low complexity region 771 811 N/A INTRINSIC
low complexity region 840 879 N/A INTRINSIC
low complexity region 890 909 N/A INTRINSIC
low complexity region 950 989 N/A INTRINSIC
low complexity region 993 1011 N/A INTRINSIC
low complexity region 1044 1068 N/A INTRINSIC
low complexity region 1284 1317 N/A INTRINSIC
JmjC 1337 1500 1.61e-47 SMART
Blast:JmjC 1536 1600 1e-18 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000108660
SMART Domains Protein: ENSMUSP00000104300
Gene: ENSMUSG00000044795

DomainStartEndE-ValueType
Cyt-b5 20 92 1.89e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124932
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129924
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134903
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142126
Predicted Effect probably benign
Transcript: ENSMUST00000144531
SMART Domains Protein: ENSMUSP00000123155
Gene: ENSMUSG00000059278

DomainStartEndE-ValueType
low complexity region 18 36 N/A INTRINSIC
Sm 43 114 4.26e-15 SMART
Meta Mutation Damage Score 0.198 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 98% (55/56)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik A T 15: 82,065,864 M1321L probably benign Het
Adra1a C T 14: 66,727,734 T391I probably benign Het
Atf7ip C A 6: 136,606,814 A1281D probably damaging Het
BC005624 T C 2: 30,976,011 N141S probably benign Het
Catsperg2 A T 7: 29,697,832 L1082Q possibly damaging Het
Cavin2 C T 1: 51,289,839 R152C probably damaging Het
Ccdc33 C T 9: 58,033,206 probably benign Het
Cfap43 T C 19: 47,795,696 D466G probably benign Het
Cfap46 C A 7: 139,650,942 M923I probably damaging Het
Chd1l T A 3: 97,572,567 K621N probably benign Het
Cnksr1 A G 4: 134,228,264 probably benign Het
Cym T C 3: 107,219,764 H25R probably benign Het
Dagla T A 19: 10,271,125 D57V probably damaging Het
Dnah3 TTCCTC TTC 7: 119,951,021 probably benign Het
Dse T A 10: 34,153,042 D684V probably damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fbxo10 A T 4: 45,058,760 S326T probably benign Het
Galntl5 G T 5: 25,186,093 probably benign Het
Grm5 A G 7: 87,804,024 R290G possibly damaging Het
Gtpbp3 A G 8: 71,492,555 T425A probably benign Het
Hepacam2 A G 6: 3,476,073 I284T probably damaging Het
Ifi205 A C 1: 174,026,692 probably null Het
Irs3 T C 5: 137,644,286 T297A probably benign Het
Kmt2d G A 15: 98,852,109 probably benign Het
Map4k4 T A 1: 39,999,876 probably benign Het
Mfsd6 T C 1: 52,658,383 S782G probably benign Het
Mis18a G A 16: 90,727,081 silent Het
Mtpn C T 6: 35,512,290 D100N probably benign Het
Myom2 G A 8: 15,131,182 probably null Het
Olfr1002 A G 2: 85,647,895 V142A probably benign Het
Olfr211 A T 6: 116,493,939 E110V probably damaging Het
Pde3b C T 7: 114,508,871 T568I probably benign Het
Pkhd1 G T 1: 20,381,461 D2203E probably benign Het
Ppp1r36 A G 12: 76,426,792 K66E possibly damaging Het
Rfc1 C A 5: 65,293,787 M319I probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Runx1t1 T C 4: 13,881,068 V456A probably damaging Het
Rxfp2 A G 5: 150,043,124 K109R probably benign Het
Sgo2a T G 1: 58,016,397 V580G probably damaging Het
Skint9 T C 4: 112,413,883 Q110R probably benign Het
Slc38a9 A G 13: 112,731,501 Y507C probably damaging Het
Smarca4 T A 9: 21,677,942 probably benign Het
Tmem55b T C 14: 50,929,042 T160A probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tns3 A C 11: 8,434,580 F1413V probably damaging Het
Trpm8 T C 1: 88,384,711 *1105Q probably null Het
Wdyhv1 A G 15: 58,153,660 N157S probably benign Het
Zfp853 C T 5: 143,288,669 V399M unknown Het
Zim1 T C 7: 6,678,116 R183G probably benign Het
Zmiz1 T C 14: 25,656,930 S871P probably damaging Het
Other mutations in Tmem88
AlleleSourceChrCoordTypePredicted EffectPPH Score
R2009:Tmem88 UTSW 11 69397776 missense probably damaging 1.00
R2106:Tmem88 UTSW 11 69397859 missense probably benign
R5845:Tmem88 UTSW 11 69397678 missense probably benign
X0060:Tmem88 UTSW 11 69397812 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATTCAGCTGTTCCATCAAAGGG -3'
(R):5'- CACAGTTTCTGCGCTCTCAG -3'

Sequencing Primer
(F):5'- ATGGTAGGATCCGGCTCAG -3'
(R):5'- AGGCACCCCTTTGCACC -3'
Posted On2016-12-20