Incidental Mutation 'R5844:Zmiz1'
ID450609
Institutional Source Beutler Lab
Gene Symbol Zmiz1
Ensembl Gene ENSMUSG00000007817
Gene Namezinc finger, MIZ-type containing 1
SynonymsRai17, Zimp10
MMRRC Submission 044062-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5844 (G1)
Quality Score179
Status Validated
Chromosome14
Chromosomal Location25459185-25666743 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 25656930 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 871 (S871P)
Ref Sequence ENSEMBL: ENSMUSP00000007961 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007961] [ENSMUST00000162645]
Predicted Effect probably damaging
Transcript: ENSMUST00000007961
AA Change: S871P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000007961
Gene: ENSMUSG00000007817
AA Change: S871P

DomainStartEndE-ValueType
low complexity region 123 142 N/A INTRINSIC
low complexity region 183 201 N/A INTRINSIC
low complexity region 239 268 N/A INTRINSIC
SCOP:d1gkub1 280 323 1e-3 SMART
low complexity region 431 446 N/A INTRINSIC
low complexity region 483 495 N/A INTRINSIC
low complexity region 498 505 N/A INTRINSIC
low complexity region 511 526 N/A INTRINSIC
Pfam:zf-Nse 731 786 3.5e-8 PFAM
Pfam:zf-MIZ 739 788 7.6e-26 PFAM
low complexity region 867 881 N/A INTRINSIC
low complexity region 982 997 N/A INTRINSIC
low complexity region 1039 1062 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162546
Predicted Effect probably damaging
Transcript: ENSMUST00000162645
AA Change: S877P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124863
Gene: ENSMUSG00000007817
AA Change: S877P

DomainStartEndE-ValueType
low complexity region 123 142 N/A INTRINSIC
low complexity region 183 201 N/A INTRINSIC
low complexity region 239 268 N/A INTRINSIC
SCOP:d1gkub1 280 309 2e-3 SMART
low complexity region 437 452 N/A INTRINSIC
low complexity region 489 501 N/A INTRINSIC
low complexity region 504 511 N/A INTRINSIC
low complexity region 517 532 N/A INTRINSIC
Pfam:zf-MIZ 745 794 2.1e-26 PFAM
low complexity region 873 887 N/A INTRINSIC
low complexity region 988 1003 N/A INTRINSIC
low complexity region 1045 1068 N/A INTRINSIC
Meta Mutation Damage Score 0.168 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the PIAS (protein inhibitor of activated STAT) family of proteins. The encoded protein regulates the activity of various transcription factors, including the androgen receptor, Smad3/4, and p53. The encoded protein may also play a role in sumoylation. A translocation between this locus on chromosome 10 and the protein tyrosine kinase ABL1 locus on chromosome 9 has been associated with acute lymphoblastic leukemia. [provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality during organogenesis with failure of yolk sac vascular remodeling and abnormal embryonic vascular development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik A T 15: 82,065,864 M1321L probably benign Het
Adra1a C T 14: 66,727,734 T391I probably benign Het
Atf7ip C A 6: 136,606,814 A1281D probably damaging Het
BC005624 T C 2: 30,976,011 N141S probably benign Het
Catsperg2 A T 7: 29,697,832 L1082Q possibly damaging Het
Cavin2 C T 1: 51,289,839 R152C probably damaging Het
Ccdc33 C T 9: 58,033,206 probably benign Het
Cfap43 T C 19: 47,795,696 D466G probably benign Het
Cfap46 C A 7: 139,650,942 M923I probably damaging Het
Chd1l T A 3: 97,572,567 K621N probably benign Het
Cnksr1 A G 4: 134,228,264 probably benign Het
Cym T C 3: 107,219,764 H25R probably benign Het
Dagla T A 19: 10,271,125 D57V probably damaging Het
Dnah3 TTCCTC TTC 7: 119,951,021 probably benign Het
Dse T A 10: 34,153,042 D684V probably damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fbxo10 A T 4: 45,058,760 S326T probably benign Het
Galntl5 G T 5: 25,186,093 probably benign Het
Grm5 A G 7: 87,804,024 R290G possibly damaging Het
Gtpbp3 A G 8: 71,492,555 T425A probably benign Het
Hepacam2 A G 6: 3,476,073 I284T probably damaging Het
Ifi205 A C 1: 174,026,692 probably null Het
Irs3 T C 5: 137,644,286 T297A probably benign Het
Kmt2d G A 15: 98,852,109 probably benign Het
Map4k4 T A 1: 39,999,876 probably benign Het
Mfsd6 T C 1: 52,658,383 S782G probably benign Het
Mis18a G A 16: 90,727,081 silent Het
Mtpn C T 6: 35,512,290 D100N probably benign Het
Myom2 G A 8: 15,131,182 probably null Het
Olfr1002 A G 2: 85,647,895 V142A probably benign Het
Olfr211 A T 6: 116,493,939 E110V probably damaging Het
Pde3b C T 7: 114,508,871 T568I probably benign Het
Pkhd1 G T 1: 20,381,461 D2203E probably benign Het
Ppp1r36 A G 12: 76,426,792 K66E possibly damaging Het
Rfc1 C A 5: 65,293,787 M319I probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Runx1t1 T C 4: 13,881,068 V456A probably damaging Het
Rxfp2 A G 5: 150,043,124 K109R probably benign Het
Sgo2a T G 1: 58,016,397 V580G probably damaging Het
Skint9 T C 4: 112,413,883 Q110R probably benign Het
Slc38a9 A G 13: 112,731,501 Y507C probably damaging Het
Smarca4 T A 9: 21,677,942 probably benign Het
Tmem55b T C 14: 50,929,042 T160A probably benign Het
Tmem88 C G 11: 69,397,678 Q138H probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tns3 A C 11: 8,434,580 F1413V probably damaging Het
Trpm8 T C 1: 88,384,711 *1105Q probably null Het
Wdyhv1 A G 15: 58,153,660 N157S probably benign Het
Zfp853 C T 5: 143,288,669 V399M unknown Het
Zim1 T C 7: 6,678,116 R183G probably benign Het
Other mutations in Zmiz1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00553:Zmiz1 APN 14 25572070 start codon destroyed probably null 0.53
IGL01582:Zmiz1 APN 14 25658230 missense probably benign 0.00
IGL01601:Zmiz1 APN 14 25581644 missense possibly damaging 0.68
IGL02008:Zmiz1 APN 14 25656879 missense probably damaging 0.97
IGL02395:Zmiz1 APN 14 25656763 missense probably damaging 1.00
IGL02836:Zmiz1 APN 14 25656742 splice site probably benign
zapp UTSW 14 25662980 missense unknown
R0144:Zmiz1 UTSW 14 25655247 missense probably damaging 1.00
R0255:Zmiz1 UTSW 14 25654495 splice site probably benign
R1006:Zmiz1 UTSW 14 25662980 missense unknown
R1160:Zmiz1 UTSW 14 25654512 missense probably damaging 1.00
R1222:Zmiz1 UTSW 14 25658096 splice site probably benign
R2846:Zmiz1 UTSW 14 25645675 missense probably benign 0.03
R4126:Zmiz1 UTSW 14 25656930 missense possibly damaging 0.94
R4373:Zmiz1 UTSW 14 25636010 missense probably damaging 0.97
R4374:Zmiz1 UTSW 14 25636010 missense probably damaging 0.97
R4377:Zmiz1 UTSW 14 25636010 missense probably damaging 0.97
R4533:Zmiz1 UTSW 14 25645660 missense probably damaging 1.00
R4726:Zmiz1 UTSW 14 25643674 critical splice donor site probably null
R5295:Zmiz1 UTSW 14 25656347 missense probably damaging 1.00
R5385:Zmiz1 UTSW 14 25649813 missense probably damaging 1.00
R5579:Zmiz1 UTSW 14 25644856 missense probably damaging 0.96
R5761:Zmiz1 UTSW 14 25651304 missense possibly damaging 0.86
R5761:Zmiz1 UTSW 14 25651306 missense probably damaging 1.00
R5875:Zmiz1 UTSW 14 25635966 missense possibly damaging 0.55
R6051:Zmiz1 UTSW 14 25572070 start codon destroyed probably null 0.53
R6919:Zmiz1 UTSW 14 25643638 missense probably damaging 1.00
R7083:Zmiz1 UTSW 14 25651948 missense probably damaging 1.00
R7216:Zmiz1 UTSW 14 25576200 frame shift probably null
R7216:Zmiz1 UTSW 14 25576207 missense probably damaging 0.99
R7216:Zmiz1 UTSW 14 25576209 missense probably damaging 0.99
R7233:Zmiz1 UTSW 14 25649668 missense possibly damaging 0.61
X0023:Zmiz1 UTSW 14 25649684 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TCACCATTGACCCCACGT -3'
(R):5'- CATTCTCCCAAGTCCAGTGACC -3'

Sequencing Primer
(F):5'- ATTGACCCCACGTGCAGC -3'
(R):5'- TCTGGGAATTGAACCTACGC -3'
Posted On2016-12-20