Incidental Mutation 'R5696:Ltk'
ID450642
Institutional Source Beutler Lab
Gene Symbol Ltk
Ensembl Gene ENSMUSG00000027297
Gene Nameleukocyte tyrosine kinase
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.286) question?
Stock #R5696 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location119751320-119760431 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 119759599 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 49 (T49S)
Ref Sequence ENSEMBL: ENSMUSP00000080774 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028759] [ENSMUST00000048493] [ENSMUST00000082130] [ENSMUST00000099529] [ENSMUST00000110793] [ENSMUST00000136419] [ENSMUST00000140224] [ENSMUST00000182203] [ENSMUST00000184294]
Predicted Effect probably benign
Transcript: ENSMUST00000028759
AA Change: T49S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000028759
Gene: ENSMUSG00000027297
AA Change: T49S

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Gly_rich 111 381 2.4e-21 PFAM
transmembrane domain 423 445 N/A INTRINSIC
TyrKc 506 773 2.61e-127 SMART
low complexity region 824 841 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000048493
SMART Domains Protein: ENSMUSP00000037275
Gene: ENSMUSG00000034032

DomainStartEndE-ValueType
low complexity region 62 81 N/A INTRINSIC
Pfam:RPAP1_N 225 270 2.4e-21 PFAM
Pfam:RPAP1_C 372 438 1.9e-27 PFAM
low complexity region 451 473 N/A INTRINSIC
low complexity region 476 488 N/A INTRINSIC
low complexity region 515 529 N/A INTRINSIC
low complexity region 739 752 N/A INTRINSIC
low complexity region 843 860 N/A INTRINSIC
low complexity region 989 1007 N/A INTRINSIC
low complexity region 1042 1052 N/A INTRINSIC
low complexity region 1097 1108 N/A INTRINSIC
low complexity region 1193 1204 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000082130
AA Change: T49S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000080774
Gene: ENSMUSG00000027297
AA Change: T49S

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Gly_rich 109 294 6.1e-16 PFAM
transmembrane domain 362 384 N/A INTRINSIC
TyrKc 445 712 2.61e-127 SMART
low complexity region 763 780 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099529
SMART Domains Protein: ENSMUSP00000097127
Gene: ENSMUSG00000034032

DomainStartEndE-ValueType
low complexity region 62 81 N/A INTRINSIC
Pfam:RPAP1_N 224 272 1.7e-21 PFAM
Pfam:RPAP1_C 370 440 2.9e-27 PFAM
low complexity region 451 473 N/A INTRINSIC
low complexity region 476 488 N/A INTRINSIC
low complexity region 515 529 N/A INTRINSIC
low complexity region 739 752 N/A INTRINSIC
low complexity region 843 860 N/A INTRINSIC
low complexity region 989 1007 N/A INTRINSIC
low complexity region 1042 1052 N/A INTRINSIC
low complexity region 1097 1108 N/A INTRINSIC
low complexity region 1193 1204 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110793
SMART Domains Protein: ENSMUSP00000106420
Gene: ENSMUSG00000034032

DomainStartEndE-ValueType
low complexity region 62 81 N/A INTRINSIC
Pfam:RPAP1_N 224 272 1.7e-21 PFAM
Pfam:RPAP1_C 370 440 2.9e-27 PFAM
low complexity region 451 473 N/A INTRINSIC
low complexity region 476 488 N/A INTRINSIC
low complexity region 515 529 N/A INTRINSIC
low complexity region 739 752 N/A INTRINSIC
low complexity region 843 860 N/A INTRINSIC
low complexity region 989 1007 N/A INTRINSIC
low complexity region 1042 1052 N/A INTRINSIC
low complexity region 1097 1108 N/A INTRINSIC
low complexity region 1193 1204 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127470
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134295
Predicted Effect probably benign
Transcript: ENSMUST00000136419
SMART Domains Protein: ENSMUSP00000138619
Gene: ENSMUSG00000034032

DomainStartEndE-ValueType
low complexity region 62 81 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140224
SMART Domains Protein: ENSMUSP00000123020
Gene: ENSMUSG00000027297

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
transmembrane domain 111 133 N/A INTRINSIC
TyrKc 194 461 1.2e-129 SMART
low complexity region 512 529 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182203
SMART Domains Protein: ENSMUSP00000138201
Gene: ENSMUSG00000027297

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
transmembrane domain 111 133 N/A INTRINSIC
TyrKc 194 461 2.61e-127 SMART
low complexity region 512 529 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184294
SMART Domains Protein: ENSMUSP00000138873
Gene: ENSMUSG00000034032

DomainStartEndE-ValueType
low complexity region 62 81 N/A INTRINSIC
Pfam:RPAP1_N 224 272 4.8e-22 PFAM
Pfam:RPAP1_C 370 440 1.2e-27 PFAM
low complexity region 451 473 N/A INTRINSIC
low complexity region 476 488 N/A INTRINSIC
low complexity region 515 529 N/A INTRINSIC
low complexity region 739 752 N/A INTRINSIC
low complexity region 843 860 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the ros/insulin receptor family of tyrosine kinases. Tyrosine-specific phosphorylation of proteins is a key to the control of diverse pathways leading to cell growth and differentiation. Four alternatively spliced transcript variants encoding different isoforms have been described for this gene. These transcripts are expressed in a tissue-specific manner in lymphocytes, brain and neuroblastoma cells, and the encoded isoforms exhibit different subcellular localization. The lymphocyte and brain specific variants initiate translation at non-AUG (CUG) start codons. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam8 G A 7: 139,989,246 R186W probably benign Het
Afg3l2 A G 18: 67,407,459 I660T probably damaging Het
Amtn T A 5: 88,385,085 Y186* probably null Het
Atrip A G 9: 109,065,501 S453P possibly damaging Het
Bahcc1 T C 11: 120,273,987 L840P probably damaging Het
Capn2 T C 1: 182,478,600 E527G possibly damaging Het
Caprin2 A T 6: 148,877,818 Y164N possibly damaging Het
Ccnh T A 13: 85,196,327 probably null Het
Cdon G T 9: 35,491,866 V1091F possibly damaging Het
Ceacam14 A G 7: 17,814,342 Y119C probably damaging Het
Ces2h A G 8: 105,018,979 K445E possibly damaging Het
Cfap46 A G 7: 139,612,031 S2357P probably damaging Het
Commd4 A T 9: 57,156,215 S86R possibly damaging Het
Cpsf6 A T 10: 117,361,029 probably benign Het
Dag1 A T 9: 108,209,447 V165E probably benign Het
Dmxl1 A T 18: 49,931,941 K2618* probably null Het
Dnah17 A G 11: 118,101,056 Y1229H probably benign Het
Endov T A 11: 119,491,799 L24Q probably damaging Het
Fam214a A G 9: 75,010,117 E666G probably benign Het
Fap C T 2: 62,502,459 V717M probably damaging Het
Fbxl2 A G 9: 113,986,478 L239P probably damaging Het
Fbxl5 A T 5: 43,758,840 V367D possibly damaging Het
Fkbp10 G T 11: 100,423,526 W384L probably damaging Het
Gbp8 C T 5: 105,018,816 V216I possibly damaging Het
Gclm G A 3: 122,266,287 A239T probably benign Het
Gm11569 C T 11: 99,798,730 probably benign Het
Gm14124 C T 2: 150,269,474 H695Y possibly damaging Het
Gnas C A 2: 174,299,675 probably benign Het
Grb10 T A 11: 11,933,566 N508I probably benign Het
Gykl1 T G 18: 52,694,195 I158M probably benign Het
Ide G A 19: 37,318,021 T214M unknown Het
Il12rb2 T A 6: 67,295,278 Q341H possibly damaging Het
Ints1 T C 5: 139,754,989 E1946G probably benign Het
Kdelr3 T C 15: 79,525,899 probably null Het
Kif1b A C 4: 149,273,849 probably null Het
Kri1 A G 9: 21,280,237 I320T probably damaging Het
Krt9 TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC 11: 100,189,077 probably benign Het
Lin9 T C 1: 180,659,081 S111P probably benign Het
Lpcat2b C A 5: 107,432,907 P34Q probably damaging Het
Map3k9 A T 12: 81,734,122 H421Q probably benign Het
Mapkbp1 T A 2: 120,021,720 probably null Het
Mcm4 A G 16: 15,625,570 S830P probably damaging Het
Nek10 T A 14: 14,860,736 probably null Het
Nlrp9b A T 7: 20,024,492 R551S probably benign Het
Nol4l T C 2: 153,418,106 T143A probably damaging Het
Olfr1346 T C 7: 6,474,743 probably null Het
Olfr1355 A T 10: 78,880,085 R304S probably benign Het
Olfr398 T C 11: 73,984,536 H24R possibly damaging Het
Olfr578 T A 7: 102,984,541 T208S probably benign Het
Pde4dip G T 3: 97,709,490 A1812D probably damaging Het
Plekhb1 C A 7: 100,656,753 G26C probably damaging Het
Polr1a T A 6: 71,929,426 F409I probably benign Het
Ptpn13 T A 5: 103,554,759 M1197K probably benign Het
Qrich2 T C 11: 116,445,002 I2114V probably damaging Het
Rbm27 T C 18: 42,317,666 Y449H probably damaging Het
Rp1l1 A G 14: 64,029,746 D927G probably damaging Het
Secisbp2 C A 13: 51,679,821 Q666K probably damaging Het
Slc45a2 T C 15: 11,001,133 I106T probably damaging Het
Slx4 G T 16: 3,979,967 Q1518K probably damaging Het
Smim10l1 T C 6: 133,105,526 F12S probably damaging Het
Son T C 16: 91,671,413 V306A possibly damaging Het
Stab1 A G 14: 31,160,221 S506P probably benign Het
Syne2 A C 12: 75,994,145 D3859A probably benign Het
Tab1 T A 15: 80,148,729 Y71* probably null Het
Tarbp1 A C 8: 126,447,340 M909R probably damaging Het
Tex15 T G 8: 33,573,192 S1157R probably benign Het
Tnni3 G A 7: 4,520,454 T120I probably benign Het
Ttn T C 2: 76,917,544 E4387G probably benign Het
Ugt3a2 G A 15: 9,361,448 silent Het
Unc5d T C 8: 28,666,842 I783V probably benign Het
Usp40 T C 1: 87,995,752 T266A probably benign Het
Vmn2r59 C T 7: 42,046,044 V315I probably benign Het
Zbtb48 G T 4: 152,020,610 H532N probably damaging Het
Other mutations in Ltk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00832:Ltk APN 2 119755605 splice site probably benign
IGL01287:Ltk APN 2 119755705 missense probably benign 0.26
IGL01339:Ltk APN 2 119752974 missense probably damaging 1.00
IGL01614:Ltk APN 2 119753487 missense probably damaging 1.00
IGL01827:Ltk APN 2 119752738 missense probably damaging 1.00
IGL02229:Ltk APN 2 119758573 missense probably benign 0.01
R2105:Ltk UTSW 2 119752088 missense probably damaging 1.00
R3763:Ltk UTSW 2 119751837 missense probably benign 0.01
R4119:Ltk UTSW 2 119757948 intron probably benign
R4120:Ltk UTSW 2 119757948 intron probably benign
R4257:Ltk UTSW 2 119753004 missense possibly damaging 0.52
R4460:Ltk UTSW 2 119755613 critical splice donor site probably null
R4888:Ltk UTSW 2 119753227 missense probably damaging 1.00
R5121:Ltk UTSW 2 119753227 missense probably damaging 1.00
R5784:Ltk UTSW 2 119754359 nonsense probably null
R6301:Ltk UTSW 2 119751757 missense probably damaging 1.00
R6470:Ltk UTSW 2 119753035 splice site probably null
R6860:Ltk UTSW 2 119754594 nonsense probably null
R7083:Ltk UTSW 2 119752074 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACGCTGCTTCCTGTGTATG -3'
(R):5'- TGAGTGGCTATCCATCTCTTATGTC -3'

Sequencing Primer
(F):5'- GTATGCCCCATCGCACTGTG -3'
(R):5'- ATGTCTCCCCTGTCACATTCTG -3'
Posted On2017-01-03