Incidental Mutation 'R5696:Cpsf6'
ID450684
Institutional Source Beutler Lab
Gene Symbol Cpsf6
Ensembl Gene ENSMUSG00000055531
Gene Namecleavage and polyadenylation specific factor 6
SynonymsHPBRII-4, CFIM68, 4733401N12Rik, HPBRII-7
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.947) question?
Stock #R5696 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location117344673-117380015 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to T at 117361029 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000135550 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069168] [ENSMUST00000176480] [ENSMUST00000176670] [ENSMUST00000176686] [ENSMUST00000177145]
Predicted Effect unknown
Transcript: ENSMUST00000069168
AA Change: H342Q
SMART Domains Protein: ENSMUSP00000068408
Gene: ENSMUSG00000055531
AA Change: H342Q

DomainStartEndE-ValueType
RRM 82 157 8.79e-11 SMART
low complexity region 182 365 N/A INTRINSIC
low complexity region 376 400 N/A INTRINSIC
low complexity region 422 438 N/A INTRINSIC
low complexity region 489 551 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000175888
Predicted Effect probably benign
Transcript: ENSMUST00000176480
SMART Domains Protein: ENSMUSP00000135550
Gene: ENSMUSG00000055531

DomainStartEndE-ValueType
low complexity region 6 30 N/A INTRINSIC
low complexity region 52 68 N/A INTRINSIC
low complexity region 119 182 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176567
Predicted Effect unknown
Transcript: ENSMUST00000176670
AA Change: H379Q
SMART Domains Protein: ENSMUSP00000135150
Gene: ENSMUSG00000055531
AA Change: H379Q

DomainStartEndE-ValueType
RRM 82 157 8.79e-11 SMART
low complexity region 182 232 N/A INTRINSIC
low complexity region 273 402 N/A INTRINSIC
low complexity region 413 437 N/A INTRINSIC
low complexity region 459 475 N/A INTRINSIC
low complexity region 526 588 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000176686
AA Change: H342Q
SMART Domains Protein: ENSMUSP00000134823
Gene: ENSMUSG00000055531
AA Change: H342Q

DomainStartEndE-ValueType
RRM 82 157 8.79e-11 SMART
low complexity region 182 365 N/A INTRINSIC
low complexity region 376 400 N/A INTRINSIC
low complexity region 422 438 N/A INTRINSIC
low complexity region 489 552 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000177145
AA Change: H342Q
SMART Domains Protein: ENSMUSP00000135136
Gene: ENSMUSG00000055531
AA Change: H342Q

DomainStartEndE-ValueType
RRM 82 157 8.79e-11 SMART
low complexity region 182 365 N/A INTRINSIC
low complexity region 376 400 N/A INTRINSIC
low complexity region 422 438 N/A INTRINSIC
low complexity region 489 551 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one subunit of a cleavage factor required for 3' RNA cleavage and polyadenylation processing. The interaction of the protein with the RNA is one of the earliest steps in the assembly of the 3' end processing complex and facilitates the recruitment of other processing factors. The cleavage factor complex is composed of four polypeptides. This gene encodes the 68kD subunit. It has a domain organization reminiscent of spliceosomal proteins. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam8 G A 7: 139,989,246 R186W probably benign Het
Afg3l2 A G 18: 67,407,459 I660T probably damaging Het
Amtn T A 5: 88,385,085 Y186* probably null Het
Atrip A G 9: 109,065,501 S453P possibly damaging Het
Bahcc1 T C 11: 120,273,987 L840P probably damaging Het
Capn2 T C 1: 182,478,600 E527G possibly damaging Het
Caprin2 A T 6: 148,877,818 Y164N possibly damaging Het
Ccnh T A 13: 85,196,327 probably null Het
Cdon G T 9: 35,491,866 V1091F possibly damaging Het
Ceacam14 A G 7: 17,814,342 Y119C probably damaging Het
Ces2h A G 8: 105,018,979 K445E possibly damaging Het
Cfap46 A G 7: 139,612,031 S2357P probably damaging Het
Commd4 A T 9: 57,156,215 S86R possibly damaging Het
Dag1 A T 9: 108,209,447 V165E probably benign Het
Dmxl1 A T 18: 49,931,941 K2618* probably null Het
Dnah17 A G 11: 118,101,056 Y1229H probably benign Het
Endov T A 11: 119,491,799 L24Q probably damaging Het
Fam214a A G 9: 75,010,117 E666G probably benign Het
Fap C T 2: 62,502,459 V717M probably damaging Het
Fbxl2 A G 9: 113,986,478 L239P probably damaging Het
Fbxl5 A T 5: 43,758,840 V367D possibly damaging Het
Fkbp10 G T 11: 100,423,526 W384L probably damaging Het
Gbp8 C T 5: 105,018,816 V216I possibly damaging Het
Gclm G A 3: 122,266,287 A239T probably benign Het
Gm11569 C T 11: 99,798,730 probably benign Het
Gm14124 C T 2: 150,269,474 H695Y possibly damaging Het
Gnas C A 2: 174,299,675 probably benign Het
Grb10 T A 11: 11,933,566 N508I probably benign Het
Gykl1 T G 18: 52,694,195 I158M probably benign Het
Ide G A 19: 37,318,021 T214M unknown Het
Il12rb2 T A 6: 67,295,278 Q341H possibly damaging Het
Ints1 T C 5: 139,754,989 E1946G probably benign Het
Kdelr3 T C 15: 79,525,899 probably null Het
Kif1b A C 4: 149,273,849 probably null Het
Kri1 A G 9: 21,280,237 I320T probably damaging Het
Krt9 TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC 11: 100,189,077 probably benign Het
Lin9 T C 1: 180,659,081 S111P probably benign Het
Lpcat2b C A 5: 107,432,907 P34Q probably damaging Het
Ltk T A 2: 119,759,599 T49S probably benign Het
Map3k9 A T 12: 81,734,122 H421Q probably benign Het
Mapkbp1 T A 2: 120,021,720 probably null Het
Mcm4 A G 16: 15,625,570 S830P probably damaging Het
Nek10 T A 14: 14,860,736 probably null Het
Nlrp9b A T 7: 20,024,492 R551S probably benign Het
Nol4l T C 2: 153,418,106 T143A probably damaging Het
Olfr1346 T C 7: 6,474,743 probably null Het
Olfr1355 A T 10: 78,880,085 R304S probably benign Het
Olfr398 T C 11: 73,984,536 H24R possibly damaging Het
Olfr578 T A 7: 102,984,541 T208S probably benign Het
Pde4dip G T 3: 97,709,490 A1812D probably damaging Het
Plekhb1 C A 7: 100,656,753 G26C probably damaging Het
Polr1a T A 6: 71,929,426 F409I probably benign Het
Ptpn13 T A 5: 103,554,759 M1197K probably benign Het
Qrich2 T C 11: 116,445,002 I2114V probably damaging Het
Rbm27 T C 18: 42,317,666 Y449H probably damaging Het
Rp1l1 A G 14: 64,029,746 D927G probably damaging Het
Secisbp2 C A 13: 51,679,821 Q666K probably damaging Het
Slc45a2 T C 15: 11,001,133 I106T probably damaging Het
Slx4 G T 16: 3,979,967 Q1518K probably damaging Het
Smim10l1 T C 6: 133,105,526 F12S probably damaging Het
Son T C 16: 91,671,413 V306A possibly damaging Het
Stab1 A G 14: 31,160,221 S506P probably benign Het
Syne2 A C 12: 75,994,145 D3859A probably benign Het
Tab1 T A 15: 80,148,729 Y71* probably null Het
Tarbp1 A C 8: 126,447,340 M909R probably damaging Het
Tex15 T G 8: 33,573,192 S1157R probably benign Het
Tnni3 G A 7: 4,520,454 T120I probably benign Het
Ttn T C 2: 76,917,544 E4387G probably benign Het
Ugt3a2 G A 15: 9,361,448 silent Het
Unc5d T C 8: 28,666,842 I783V probably benign Het
Usp40 T C 1: 87,995,752 T266A probably benign Het
Vmn2r59 C T 7: 42,046,044 V315I probably benign Het
Zbtb48 G T 4: 152,020,610 H532N probably damaging Het
Other mutations in Cpsf6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Cpsf6 APN 10 117366129 unclassified probably benign
IGL03018:Cpsf6 APN 10 117367956 missense probably benign 0.02
IGL03392:Cpsf6 APN 10 117367979 missense probably damaging 1.00
R1006:Cpsf6 UTSW 10 117366068 splice site probably benign
R1239:Cpsf6 UTSW 10 117361343 unclassified probably benign
R1611:Cpsf6 UTSW 10 117361828 intron probably benign
R2041:Cpsf6 UTSW 10 117359128 missense probably damaging 0.99
R2117:Cpsf6 UTSW 10 117366120 unclassified probably benign
R2225:Cpsf6 UTSW 10 117363036 unclassified probably benign
R4752:Cpsf6 UTSW 10 117361368 splice site probably benign
R5001:Cpsf6 UTSW 10 117367961 missense possibly damaging 0.71
R5176:Cpsf6 UTSW 10 117361284 unclassified probably benign
R5393:Cpsf6 UTSW 10 117362016 unclassified probably benign
Z1088:Cpsf6 UTSW 10 117356041 missense unknown
Predicted Primers PCR Primer
(F):5'- CTGACTAAAGAGTTTCAGTACGACATG -3'
(R):5'- TTCCTGGACAACCTTTTGGG -3'

Sequencing Primer
(F):5'- ATGTTTAACTTACCTCCCAGGGGG -3'
(R):5'- ACAACCTTTTGGGCAGCC -3'
Posted On2017-01-03