Incidental Mutation 'R5696:Secisbp2'
ID450696
Institutional Source Beutler Lab
Gene Symbol Secisbp2
Ensembl Gene ENSMUSG00000035139
Gene NameSECIS binding protein 2
SynonymsSBP2, 2210413N07Rik, 2810012K13Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.153) question?
Stock #R5696 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location51651697-51684044 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 51679821 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 666 (Q666K)
Ref Sequence ENSEMBL: ENSMUSP00000045740 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040117]
Predicted Effect probably damaging
Transcript: ENSMUST00000040117
AA Change: Q666K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000045740
Gene: ENSMUSG00000035139
AA Change: Q666K

DomainStartEndE-ValueType
low complexity region 179 192 N/A INTRINSIC
low complexity region 375 389 N/A INTRINSIC
low complexity region 542 553 N/A INTRINSIC
Pfam:Ribosomal_L7Ae 662 764 4.4e-23 PFAM
low complexity region 793 809 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146011
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153877
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: The incorporation of selenocysteine into a protein requires the concerted action of an mRNA element called a sec insertion sequence (SECIS), a selenocysteine-specific translation elongation factor and a SECIS binding protein. With these elements in place, a UGA codon can be decoded as selenocysteine. The gene described in this record encodes a nuclear protein that functions as a SECIS binding protein. Mutations in a similar gene in human have been associated with a reduction in activity of a specific thyroxine deiodinase, a selenocysteine-containing enzyme, and abnormal thyroid hormone metabolism. Alternate splicing results in multiple transcript variants. [provided by RefSeq, May 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete preweaning lethality while heterozygotes exhibit reduced serum selenium levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam8 G A 7: 139,989,246 R186W probably benign Het
Afg3l2 A G 18: 67,407,459 I660T probably damaging Het
Amtn T A 5: 88,385,085 Y186* probably null Het
Atrip A G 9: 109,065,501 S453P possibly damaging Het
Bahcc1 T C 11: 120,273,987 L840P probably damaging Het
Capn2 T C 1: 182,478,600 E527G possibly damaging Het
Caprin2 A T 6: 148,877,818 Y164N possibly damaging Het
Ccnh T A 13: 85,196,327 probably null Het
Cdon G T 9: 35,491,866 V1091F possibly damaging Het
Ceacam14 A G 7: 17,814,342 Y119C probably damaging Het
Ces2h A G 8: 105,018,979 K445E possibly damaging Het
Cfap46 A G 7: 139,612,031 S2357P probably damaging Het
Commd4 A T 9: 57,156,215 S86R possibly damaging Het
Cpsf6 A T 10: 117,361,029 probably benign Het
Dag1 A T 9: 108,209,447 V165E probably benign Het
Dmxl1 A T 18: 49,931,941 K2618* probably null Het
Dnah17 A G 11: 118,101,056 Y1229H probably benign Het
Endov T A 11: 119,491,799 L24Q probably damaging Het
Fam214a A G 9: 75,010,117 E666G probably benign Het
Fap C T 2: 62,502,459 V717M probably damaging Het
Fbxl2 A G 9: 113,986,478 L239P probably damaging Het
Fbxl5 A T 5: 43,758,840 V367D possibly damaging Het
Fkbp10 G T 11: 100,423,526 W384L probably damaging Het
Gbp8 C T 5: 105,018,816 V216I possibly damaging Het
Gclm G A 3: 122,266,287 A239T probably benign Het
Gm11569 C T 11: 99,798,730 probably benign Het
Gm14124 C T 2: 150,269,474 H695Y possibly damaging Het
Gnas C A 2: 174,299,675 probably benign Het
Grb10 T A 11: 11,933,566 N508I probably benign Het
Gykl1 T G 18: 52,694,195 I158M probably benign Het
Ide G A 19: 37,318,021 T214M unknown Het
Il12rb2 T A 6: 67,295,278 Q341H possibly damaging Het
Ints1 T C 5: 139,754,989 E1946G probably benign Het
Kdelr3 T C 15: 79,525,899 probably null Het
Kif1b A C 4: 149,273,849 probably null Het
Kri1 A G 9: 21,280,237 I320T probably damaging Het
Krt9 TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC 11: 100,189,077 probably benign Het
Lin9 T C 1: 180,659,081 S111P probably benign Het
Lpcat2b C A 5: 107,432,907 P34Q probably damaging Het
Ltk T A 2: 119,759,599 T49S probably benign Het
Map3k9 A T 12: 81,734,122 H421Q probably benign Het
Mapkbp1 T A 2: 120,021,720 probably null Het
Mcm4 A G 16: 15,625,570 S830P probably damaging Het
Nek10 T A 14: 14,860,736 probably null Het
Nlrp9b A T 7: 20,024,492 R551S probably benign Het
Nol4l T C 2: 153,418,106 T143A probably damaging Het
Olfr1346 T C 7: 6,474,743 probably null Het
Olfr1355 A T 10: 78,880,085 R304S probably benign Het
Olfr398 T C 11: 73,984,536 H24R possibly damaging Het
Olfr578 T A 7: 102,984,541 T208S probably benign Het
Pde4dip G T 3: 97,709,490 A1812D probably damaging Het
Plekhb1 C A 7: 100,656,753 G26C probably damaging Het
Polr1a T A 6: 71,929,426 F409I probably benign Het
Ptpn13 T A 5: 103,554,759 M1197K probably benign Het
Qrich2 T C 11: 116,445,002 I2114V probably damaging Het
Rbm27 T C 18: 42,317,666 Y449H probably damaging Het
Rp1l1 A G 14: 64,029,746 D927G probably damaging Het
Slc45a2 T C 15: 11,001,133 I106T probably damaging Het
Slx4 G T 16: 3,979,967 Q1518K probably damaging Het
Smim10l1 T C 6: 133,105,526 F12S probably damaging Het
Son T C 16: 91,671,413 V306A possibly damaging Het
Stab1 A G 14: 31,160,221 S506P probably benign Het
Syne2 A C 12: 75,994,145 D3859A probably benign Het
Tab1 T A 15: 80,148,729 Y71* probably null Het
Tarbp1 A C 8: 126,447,340 M909R probably damaging Het
Tex15 T G 8: 33,573,192 S1157R probably benign Het
Tnni3 G A 7: 4,520,454 T120I probably benign Het
Ttn T C 2: 76,917,544 E4387G probably benign Het
Ugt3a2 G A 15: 9,361,448 silent Het
Unc5d T C 8: 28,666,842 I783V probably benign Het
Usp40 T C 1: 87,995,752 T266A probably benign Het
Vmn2r59 C T 7: 42,046,044 V315I probably benign Het
Zbtb48 G T 4: 152,020,610 H532N probably damaging Het
Other mutations in Secisbp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01149:Secisbp2 APN 13 51676455 critical splice donor site probably null
IGL01316:Secisbp2 APN 13 51654516 missense probably benign 0.06
IGL02576:Secisbp2 APN 13 51670858 missense possibly damaging 0.80
IGL02630:Secisbp2 APN 13 51678906 missense possibly damaging 0.63
IGL02645:Secisbp2 APN 13 51682460 missense probably damaging 1.00
IGL03107:Secisbp2 APN 13 51652757 critical splice donor site probably null
R0208:Secisbp2 UTSW 13 51679845 missense probably benign 0.26
R0453:Secisbp2 UTSW 13 51683325 missense possibly damaging 0.91
R1220:Secisbp2 UTSW 13 51656905 missense probably damaging 1.00
R1278:Secisbp2 UTSW 13 51654510 missense probably damaging 1.00
R1439:Secisbp2 UTSW 13 51679723 splice site probably benign
R1514:Secisbp2 UTSW 13 51682095 missense possibly damaging 0.83
R1568:Secisbp2 UTSW 13 51673107 missense possibly damaging 0.73
R1724:Secisbp2 UTSW 13 51670846 missense probably benign
R2851:Secisbp2 UTSW 13 51654635 splice site probably null
R2967:Secisbp2 UTSW 13 51670879 missense probably benign 0.00
R3156:Secisbp2 UTSW 13 51662675 missense probably benign 0.06
R4393:Secisbp2 UTSW 13 51654466 missense probably damaging 1.00
R4719:Secisbp2 UTSW 13 51652732 missense possibly damaging 0.96
R4953:Secisbp2 UTSW 13 51682027 missense probably damaging 1.00
R5183:Secisbp2 UTSW 13 51665424 missense probably benign 0.14
R5432:Secisbp2 UTSW 13 51673966 small deletion probably benign
R6007:Secisbp2 UTSW 13 51665359 missense probably damaging 0.99
R6066:Secisbp2 UTSW 13 51677222 missense probably benign 0.00
R6076:Secisbp2 UTSW 13 51679777 missense probably damaging 0.98
R6164:Secisbp2 UTSW 13 51679860 missense probably damaging 1.00
R6346:Secisbp2 UTSW 13 51679887 missense probably damaging 0.99
R6367:Secisbp2 UTSW 13 51682141 missense probably damaging 1.00
R6790:Secisbp2 UTSW 13 51670903 missense probably benign 0.09
R6888:Secisbp2 UTSW 13 51679941 missense probably benign 0.16
R7095:Secisbp2 UTSW 13 51677254 missense probably benign 0.01
R7104:Secisbp2 UTSW 13 51656907 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CATTCCTTCCTGTGGTGGAG -3'
(R):5'- TGAAACTGAAAGCAAGCTGCC -3'

Sequencing Primer
(F):5'- AGGGAGTTGCATGGTCCTGC -3'
(R):5'- AGCAAGCTGCCAAGGTGC -3'
Posted On2017-01-03