Incidental Mutation 'R5697:Tchh'
ID450719
Institutional Source Beutler Lab
Gene Symbol Tchh
Ensembl Gene ENSMUSG00000052415
Gene Nametrichohyalin
SynonymsThh, AHF
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.178) question?
Stock #R5697 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location93442330-93449077 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 93445043 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 597 (R597*)
Ref Sequence ENSEMBL: ENSMUSP00000069525 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064257]
Predicted Effect probably null
Transcript: ENSMUST00000064257
AA Change: R597*
SMART Domains Protein: ENSMUSP00000069525
Gene: ENSMUSG00000052415
AA Change: R597*

DomainStartEndE-ValueType
Pfam:S_100 4 46 3.5e-15 PFAM
Blast:EFh 53 81 4e-9 BLAST
low complexity region 110 123 N/A INTRINSIC
coiled coil region 137 370 N/A INTRINSIC
internal_repeat_2 374 384 2.35e-6 PROSPERO
internal_repeat_1 382 400 4.53e-15 PROSPERO
low complexity region 403 431 N/A INTRINSIC
internal_repeat_2 432 442 2.35e-6 PROSPERO
low complexity region 443 469 N/A INTRINSIC
low complexity region 480 494 N/A INTRINSIC
low complexity region 497 511 N/A INTRINSIC
coiled coil region 516 625 N/A INTRINSIC
internal_repeat_1 627 645 4.53e-15 PROSPERO
coiled coil region 661 700 N/A INTRINSIC
low complexity region 717 734 N/A INTRINSIC
coiled coil region 738 821 N/A INTRINSIC
low complexity region 827 844 N/A INTRINSIC
low complexity region 847 864 N/A INTRINSIC
low complexity region 867 905 N/A INTRINSIC
coiled coil region 927 1049 N/A INTRINSIC
coiled coil region 1073 1263 N/A INTRINSIC
coiled coil region 1295 1570 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195137
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr8 T C 14: 29,991,673 F550S possibly damaging Het
Adamts15 G A 9: 30,911,794 T326I probably damaging Het
Akap9 T C 5: 3,960,170 L309P possibly damaging Het
Arfgef1 T C 1: 10,160,838 M1149V probably benign Het
Atp6v0a4 C T 6: 38,050,507 probably null Het
Capn9 C T 8: 124,589,071 H39Y unknown Het
Celsr2 G A 3: 108,403,921 Q1425* probably null Het
Chd6 A G 2: 161,018,051 L610P probably damaging Het
Clasp2 A T 9: 113,860,122 T424S probably benign Het
Clec5a T C 6: 40,582,270 D35G probably benign Het
Ctgf A G 10: 24,597,456 T298A probably benign Het
Dnhd1 T G 7: 105,674,188 V599G probably damaging Het
Enpep T C 3: 129,309,123 T395A probably benign Het
Evc2 G T 5: 37,370,608 L320F probably damaging Het
Fam129a T C 1: 151,700,261 F379L probably damaging Het
Gm14124 C T 2: 150,269,474 H695Y possibly damaging Het
Gm5346 A T 8: 43,626,579 W203R probably damaging Het
Hist1h2bp C T 13: 21,787,791 probably null Het
Hivep3 C T 4: 120,096,955 H823Y possibly damaging Het
Ighv1-59 C T 12: 115,335,348 E29K possibly damaging Het
Itsn1 A G 16: 91,801,589 I137V possibly damaging Het
Kntc1 A G 5: 123,765,007 T316A probably benign Het
Map4k5 T C 12: 69,830,436 T312A probably benign Het
Megf6 G T 4: 154,258,229 A642S probably null Het
Mrgprb3 G T 7: 48,642,925 L293M probably damaging Het
Nes A G 3: 87,977,848 E1138G probably damaging Het
Pias2 A G 18: 77,133,188 K373R probably damaging Het
Prss23 A G 7: 89,509,982 F293S probably damaging Het
Pzp A G 6: 128,525,189 Y66H probably benign Het
Rnf213 A G 11: 119,483,894 R5061G possibly damaging Het
Sergef A G 7: 46,639,259 probably benign Het
Slc7a1 A G 5: 148,333,982 V558A probably benign Het
Smc2 A G 4: 52,459,045 E480G probably benign Het
Smyd3 T G 1: 179,411,682 K111T probably damaging Het
Ttc6 G T 12: 57,677,214 V1043L probably benign Het
Vmn1r10 T G 6: 57,113,489 L22R probably damaging Het
Vmn2r56 T C 7: 12,715,990 D107G probably damaging Het
Zfp365 A G 10: 67,909,640 Y103H probably benign Het
Zfp39 G T 11: 58,889,835 H700Q probably benign Het
Zfp982 A T 4: 147,512,589 E134D probably benign Het
Other mutations in Tchh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Tchh APN 3 93445299 missense unknown
IGL00338:Tchh APN 3 93447644 missense unknown
IGL00541:Tchh APN 3 93446250 missense unknown
IGL02510:Tchh APN 3 93444078 missense unknown
IGL02622:Tchh APN 3 93443412 missense probably damaging 1.00
IGL03164:Tchh APN 3 93445392 missense unknown
IGL03331:Tchh APN 3 93443418 missense probably damaging 1.00
PIT4453001:Tchh UTSW 3 93445880 missense unknown
R0334:Tchh UTSW 3 93445616 missense unknown
R0603:Tchh UTSW 3 93443781 missense possibly damaging 0.91
R1186:Tchh UTSW 3 93448046 missense unknown
R1241:Tchh UTSW 3 93444972 missense unknown
R1610:Tchh UTSW 3 93444839 missense unknown
R1768:Tchh UTSW 3 93443575 missense possibly damaging 0.68
R1843:Tchh UTSW 3 93446780 missense unknown
R1866:Tchh UTSW 3 93447760 missense unknown
R1978:Tchh UTSW 3 93446799 missense unknown
R2008:Tchh UTSW 3 93445974 missense unknown
R2011:Tchh UTSW 3 93446961 missense unknown
R2087:Tchh UTSW 3 93443918 missense unknown
R2177:Tchh UTSW 3 93444132 missense unknown
R2292:Tchh UTSW 3 93442382 missense probably damaging 1.00
R2418:Tchh UTSW 3 93445629 missense unknown
R2877:Tchh UTSW 3 93444228 missense unknown
R2995:Tchh UTSW 3 93447750 small deletion probably benign
R2997:Tchh UTSW 3 93447750 small deletion probably benign
R3439:Tchh UTSW 3 93447393 missense unknown
R3440:Tchh UTSW 3 93445107 missense unknown
R3441:Tchh UTSW 3 93445107 missense unknown
R4063:Tchh UTSW 3 93446991 missense unknown
R4550:Tchh UTSW 3 93445310 missense unknown
R4720:Tchh UTSW 3 93447882 missense unknown
R4836:Tchh UTSW 3 93445148 missense unknown
R4836:Tchh UTSW 3 93447588 missense unknown
R4880:Tchh UTSW 3 93443823 missense possibly damaging 0.85
R4895:Tchh UTSW 3 93445686 missense unknown
R5188:Tchh UTSW 3 93446679 missense unknown
R5404:Tchh UTSW 3 93447675 missense unknown
R5435:Tchh UTSW 3 93443672 missense possibly damaging 0.53
R5578:Tchh UTSW 3 93444311 nonsense probably null
R5678:Tchh UTSW 3 93445626 missense unknown
R5768:Tchh UTSW 3 93446181 missense unknown
R5809:Tchh UTSW 3 93445573 missense unknown
R5934:Tchh UTSW 3 93444112 missense unknown
R5945:Tchh UTSW 3 93445337 missense unknown
R6313:Tchh UTSW 3 93447851 missense unknown
R6329:Tchh UTSW 3 93446445 missense unknown
R6397:Tchh UTSW 3 93445866 missense unknown
R6818:Tchh UTSW 3 93443411 missense probably damaging 1.00
R6997:Tchh UTSW 3 93446708 small deletion probably benign
R7174:Tchh UTSW 3 93446171 missense unknown
R7268:Tchh UTSW 3 93446708 small deletion probably benign
R7270:Tchh UTSW 3 93444530 missense unknown
Z1088:Tchh UTSW 3 93445682 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTGTTGCAAGAAGAGCAGCG -3'
(R):5'- TCTTCCTCTAGGATCTGACGG -3'

Sequencing Primer
(F):5'- CAAGAAGAGCAGCGCCAGC -3'
(R):5'- TGAGAATCTTCCAGCTGCTG -3'
Posted On2017-01-03