Incidental Mutation 'R5697:Akap9'
ID450727
Institutional Source Beutler Lab
Gene Symbol Akap9
Ensembl Gene ENSMUSG00000040407
Gene NameA kinase (PRKA) anchor protein (yotiao) 9
SynonymsAKAP450, G1-448-15, 5730481H23Rik, mei2-5, repro12
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.332) question?
Stock #R5697 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location3928054-4081310 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 3960170 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 309 (L309P)
Ref Sequence ENSEMBL: ENSMUSP00000117209 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044492] [ENSMUST00000143365]
Predicted Effect possibly damaging
Transcript: ENSMUST00000044492
AA Change: L291P

PolyPhen 2 Score 0.918 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000046129
Gene: ENSMUSG00000040407
AA Change: L291P

DomainStartEndE-ValueType
low complexity region 9 18 N/A INTRINSIC
low complexity region 33 44 N/A INTRINSIC
low complexity region 98 115 N/A INTRINSIC
Blast:HPT 126 197 6e-21 BLAST
low complexity region 237 249 N/A INTRINSIC
low complexity region 297 315 N/A INTRINSIC
coiled coil region 404 593 N/A INTRINSIC
coiled coil region 622 756 N/A INTRINSIC
coiled coil region 777 843 N/A INTRINSIC
coiled coil region 888 958 N/A INTRINSIC
low complexity region 982 997 N/A INTRINSIC
coiled coil region 1037 1065 N/A INTRINSIC
low complexity region 1233 1246 N/A INTRINSIC
internal_repeat_2 1247 1312 7.75e-5 PROSPERO
internal_repeat_1 1377 1485 2.63e-5 PROSPERO
coiled coil region 1522 1589 N/A INTRINSIC
coiled coil region 1789 2107 N/A INTRINSIC
coiled coil region 2132 2318 N/A INTRINSIC
internal_repeat_1 2322 2445 2.63e-5 PROSPERO
coiled coil region 2455 2494 N/A INTRINSIC
low complexity region 2587 2598 N/A INTRINSIC
low complexity region 2627 2640 N/A INTRINSIC
internal_repeat_2 2934 2997 7.75e-5 PROSPERO
low complexity region 3000 3016 N/A INTRINSIC
coiled coil region 3109 3307 N/A INTRINSIC
coiled coil region 3455 3493 N/A INTRINSIC
coiled coil region 3521 3556 N/A INTRINSIC
Pfam:PACT_coil_coil 3576 3657 1.2e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140977
Predicted Effect possibly damaging
Transcript: ENSMUST00000143365
AA Change: L309P

PolyPhen 2 Score 0.918 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000117209
Gene: ENSMUSG00000040407
AA Change: L309P

DomainStartEndE-ValueType
low complexity region 9 18 N/A INTRINSIC
low complexity region 33 44 N/A INTRINSIC
low complexity region 122 133 N/A INTRINSIC
Blast:HPT 144 215 9e-22 BLAST
low complexity region 255 267 N/A INTRINSIC
low complexity region 315 333 N/A INTRINSIC
coiled coil region 422 571 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177448
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a chemically induced allele exhibit male infertily with abnormal spermatogenesis and Sertoli maturation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr8 T C 14: 29,991,673 F550S possibly damaging Het
Adamts15 G A 9: 30,911,794 T326I probably damaging Het
Arfgef1 T C 1: 10,160,838 M1149V probably benign Het
Atp6v0a4 C T 6: 38,050,507 probably null Het
Capn9 C T 8: 124,589,071 H39Y unknown Het
Celsr2 G A 3: 108,403,921 Q1425* probably null Het
Chd6 A G 2: 161,018,051 L610P probably damaging Het
Clasp2 A T 9: 113,860,122 T424S probably benign Het
Clec5a T C 6: 40,582,270 D35G probably benign Het
Ctgf A G 10: 24,597,456 T298A probably benign Het
Dnhd1 T G 7: 105,674,188 V599G probably damaging Het
Enpep T C 3: 129,309,123 T395A probably benign Het
Evc2 G T 5: 37,370,608 L320F probably damaging Het
Fam129a T C 1: 151,700,261 F379L probably damaging Het
Gm14124 C T 2: 150,269,474 H695Y possibly damaging Het
Gm5346 A T 8: 43,626,579 W203R probably damaging Het
Hist1h2bp C T 13: 21,787,791 probably null Het
Hivep3 C T 4: 120,096,955 H823Y possibly damaging Het
Ighv1-59 C T 12: 115,335,348 E29K possibly damaging Het
Itsn1 A G 16: 91,801,589 I137V possibly damaging Het
Kntc1 A G 5: 123,765,007 T316A probably benign Het
Map4k5 T C 12: 69,830,436 T312A probably benign Het
Megf6 G T 4: 154,258,229 A642S probably null Het
Mrgprb3 G T 7: 48,642,925 L293M probably damaging Het
Nes A G 3: 87,977,848 E1138G probably damaging Het
Pias2 A G 18: 77,133,188 K373R probably damaging Het
Prss23 A G 7: 89,509,982 F293S probably damaging Het
Pzp A G 6: 128,525,189 Y66H probably benign Het
Rnf213 A G 11: 119,483,894 R5061G possibly damaging Het
Sergef A G 7: 46,639,259 probably benign Het
Slc7a1 A G 5: 148,333,982 V558A probably benign Het
Smc2 A G 4: 52,459,045 E480G probably benign Het
Smyd3 T G 1: 179,411,682 K111T probably damaging Het
Tchh A T 3: 93,445,043 R597* probably null Het
Ttc6 G T 12: 57,677,214 V1043L probably benign Het
Vmn1r10 T G 6: 57,113,489 L22R probably damaging Het
Vmn2r56 T C 7: 12,715,990 D107G probably damaging Het
Zfp365 A G 10: 67,909,640 Y103H probably benign Het
Zfp39 G T 11: 58,889,835 H700Q probably benign Het
Zfp982 A T 4: 147,512,589 E134D probably benign Het
Other mutations in Akap9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00478:Akap9 APN 5 4046639 missense probably damaging 0.97
IGL00642:Akap9 APN 5 3960842 missense probably damaging 0.99
IGL00786:Akap9 APN 5 4070522 missense probably damaging 1.00
IGL00788:Akap9 APN 5 4060480 missense probably damaging 1.00
IGL00969:Akap9 APN 5 4001550 missense probably benign
IGL01014:Akap9 APN 5 3968683 missense probably benign 0.41
IGL01302:Akap9 APN 5 3970711 missense probably benign 0.27
IGL01610:Akap9 APN 5 4032839 missense possibly damaging 0.95
IGL01620:Akap9 APN 5 3960218 missense probably benign 0.11
IGL01862:Akap9 APN 5 3951705 missense probably damaging 0.99
IGL01862:Akap9 APN 5 4065856 missense probably damaging 0.99
IGL02151:Akap9 APN 5 4032728 nonsense probably null
IGL02635:Akap9 APN 5 4070500 missense possibly damaging 0.59
IGL02858:Akap9 APN 5 4069130 missense possibly damaging 0.88
IGL02967:Akap9 APN 5 3976164 missense probably benign 0.07
IGL03064:Akap9 APN 5 3968755 missense probably damaging 1.00
IGL03289:Akap9 APN 5 4077261 missense probably damaging 1.00
Wee_one UTSW 5 4043925 missense probably damaging 1.00
FR4449:Akap9 UTSW 5 3981214 unclassified probably benign
PIT1430001:Akap9 UTSW 5 4029849 missense probably damaging 1.00
PIT4366001:Akap9 UTSW 5 4046221 missense probably benign 0.24
R0088:Akap9 UTSW 5 3961946 missense probably benign 0.22
R0309:Akap9 UTSW 5 4069038 missense probably benign 0.01
R0387:Akap9 UTSW 5 3951678 splice site probably benign
R0440:Akap9 UTSW 5 4064569 missense probably damaging 0.99
R0441:Akap9 UTSW 5 3961714 missense probably benign 0.15
R0491:Akap9 UTSW 5 3972851 unclassified probably benign
R0501:Akap9 UTSW 5 3970685 missense probably damaging 1.00
R0507:Akap9 UTSW 5 4069043 missense probably benign 0.41
R0544:Akap9 UTSW 5 4069185 missense probably benign 0.22
R0581:Akap9 UTSW 5 4050620 missense probably benign 0.03
R0611:Akap9 UTSW 5 3954870 missense probably benign 0.00
R0620:Akap9 UTSW 5 4064136 missense probably damaging 0.98
R0639:Akap9 UTSW 5 4060318 missense probably damaging 1.00
R0932:Akap9 UTSW 5 4046492 missense possibly damaging 0.77
R0944:Akap9 UTSW 5 4064742 synonymous probably null
R1101:Akap9 UTSW 5 4046205 missense probably benign 0.00
R1159:Akap9 UTSW 5 3960865 missense probably damaging 0.98
R1170:Akap9 UTSW 5 4055671 missense probably benign
R1185:Akap9 UTSW 5 3948783 missense probably benign 0.13
R1185:Akap9 UTSW 5 3948783 missense probably benign 0.13
R1185:Akap9 UTSW 5 3948783 missense probably benign 0.13
R1453:Akap9 UTSW 5 3975614 unclassified probably null
R1551:Akap9 UTSW 5 4069174 missense probably benign 0.02
R1608:Akap9 UTSW 5 3961783 missense probably damaging 1.00
R1652:Akap9 UTSW 5 4077210 missense probably damaging 1.00
R1659:Akap9 UTSW 5 4064633 missense probably damaging 1.00
R1713:Akap9 UTSW 5 4039345 critical splice donor site probably null
R1719:Akap9 UTSW 5 3957645 nonsense probably null
R1720:Akap9 UTSW 5 3972791 missense possibly damaging 0.63
R1757:Akap9 UTSW 5 4001667 missense probably benign 0.41
R1872:Akap9 UTSW 5 4001406 missense probably damaging 1.00
R1876:Akap9 UTSW 5 3961809 missense probably benign 0.28
R1881:Akap9 UTSW 5 4050173 missense probably benign
R1950:Akap9 UTSW 5 3960677 missense probably damaging 1.00
R1980:Akap9 UTSW 5 3972771 missense probably damaging 0.99
R1993:Akap9 UTSW 5 4038520 splice site probably null
R2008:Akap9 UTSW 5 3960131 missense possibly damaging 0.47
R2020:Akap9 UTSW 5 3961967 missense probably damaging 1.00
R2051:Akap9 UTSW 5 3975685 nonsense probably null
R2061:Akap9 UTSW 5 3961010 missense probably damaging 1.00
R2109:Akap9 UTSW 5 4044847 missense possibly damaging 0.47
R2135:Akap9 UTSW 5 4064509 missense probably damaging 1.00
R2225:Akap9 UTSW 5 4077271 missense probably damaging 0.96
R2232:Akap9 UTSW 5 4046603 missense probably damaging 1.00
R2424:Akap9 UTSW 5 4065279 missense probably damaging 0.97
R2483:Akap9 UTSW 5 3976235 missense possibly damaging 0.65
R2879:Akap9 UTSW 5 3976353 intron probably benign
R3622:Akap9 UTSW 5 3976235 missense possibly damaging 0.65
R3623:Akap9 UTSW 5 3976235 missense possibly damaging 0.65
R3624:Akap9 UTSW 5 3976235 missense possibly damaging 0.65
R3722:Akap9 UTSW 5 4070351 missense probably damaging 1.00
R3806:Akap9 UTSW 5 3954410 missense probably benign 0.00
R3919:Akap9 UTSW 5 3961764 nonsense probably null
R4023:Akap9 UTSW 5 3992077 missense possibly damaging 0.66
R4093:Akap9 UTSW 5 4043996 missense probably damaging 0.99
R4434:Akap9 UTSW 5 4032708 missense probably damaging 0.99
R4529:Akap9 UTSW 5 4043948 missense probably damaging 1.00
R4530:Akap9 UTSW 5 4043948 missense probably damaging 1.00
R4532:Akap9 UTSW 5 4043948 missense probably damaging 1.00
R4533:Akap9 UTSW 5 4043948 missense probably damaging 1.00
R4585:Akap9 UTSW 5 3976151 missense probably benign 0.00
R4586:Akap9 UTSW 5 3976151 missense probably benign 0.00
R4655:Akap9 UTSW 5 4046403 missense probably benign 0.14
R4676:Akap9 UTSW 5 4032774 missense probably damaging 1.00
R4676:Akap9 UTSW 5 4064515 nonsense probably null
R4724:Akap9 UTSW 5 4055339 missense probably benign
R4731:Akap9 UTSW 5 3962266 missense possibly damaging 0.54
R4732:Akap9 UTSW 5 4013901 missense probably damaging 0.98
R4733:Akap9 UTSW 5 4013901 missense probably damaging 0.98
R4743:Akap9 UTSW 5 3961013 missense probably damaging 1.00
R4749:Akap9 UTSW 5 3968737 missense probably benign 0.41
R4756:Akap9 UTSW 5 4001418 missense probably damaging 0.99
R4757:Akap9 UTSW 5 4008382 missense probably damaging 1.00
R4860:Akap9 UTSW 5 4034916 intron probably benign
R4937:Akap9 UTSW 5 4050145 splice site probably null
R4960:Akap9 UTSW 5 3957664 missense probably benign 0.15
R4974:Akap9 UTSW 5 3961466 missense possibly damaging 0.81
R5101:Akap9 UTSW 5 4001748 missense probably damaging 0.96
R5160:Akap9 UTSW 5 4030007 missense probably damaging 1.00
R5200:Akap9 UTSW 5 3960734 missense probably benign 0.00
R5245:Akap9 UTSW 5 3976209 missense probably damaging 0.99
R5293:Akap9 UTSW 5 3948687 missense probably damaging 0.99
R5408:Akap9 UTSW 5 4058458 missense possibly damaging 0.84
R5507:Akap9 UTSW 5 3968683 missense probably benign 0.41
R5517:Akap9 UTSW 5 4001665 missense possibly damaging 0.76
R5579:Akap9 UTSW 5 4064714 missense possibly damaging 0.93
R5619:Akap9 UTSW 5 3954760 intron probably benign
R5645:Akap9 UTSW 5 4050590 missense probably benign 0.09
R5669:Akap9 UTSW 5 4050540 nonsense probably null
R5686:Akap9 UTSW 5 3971926 missense probably benign 0.00
R5821:Akap9 UTSW 5 4046064 missense probably benign 0.13
R5875:Akap9 UTSW 5 4077285 missense probably benign 0.01
R5897:Akap9 UTSW 5 4077904 missense probably benign 0.23
R5999:Akap9 UTSW 5 4043925 missense probably damaging 1.00
R6025:Akap9 UTSW 5 4032801 missense probably damaging 1.00
R6078:Akap9 UTSW 5 4067924 critical splice donor site probably null
R6138:Akap9 UTSW 5 4067924 critical splice donor site probably null
R6225:Akap9 UTSW 5 3962105 missense probably damaging 1.00
R6243:Akap9 UTSW 5 4065000 intron probably null
R6326:Akap9 UTSW 5 3962061 missense probably damaging 1.00
R6564:Akap9 UTSW 5 4028491 missense probably damaging 0.98
R6617:Akap9 UTSW 5 3968745 missense probably benign 0.04
R6625:Akap9 UTSW 5 3968745 missense probably benign 0.04
R6632:Akap9 UTSW 5 4013842 splice site probably null
R6677:Akap9 UTSW 5 4029869 missense probably benign 0.21
R6717:Akap9 UTSW 5 4064086 missense probably damaging 1.00
R6893:Akap9 UTSW 5 3961709 missense probably benign 0.32
R6915:Akap9 UTSW 5 3960551 missense probably benign 0.03
R6938:Akap9 UTSW 5 4046628 missense possibly damaging 0.91
R6972:Akap9 UTSW 5 4046699 missense possibly damaging 0.62
R6973:Akap9 UTSW 5 4046699 missense possibly damaging 0.62
R6993:Akap9 UTSW 5 4065866 missense possibly damaging 0.65
R7032:Akap9 UTSW 5 3954896 missense probably benign
R7164:Akap9 UTSW 5 4060364 missense probably damaging 0.96
R7170:Akap9 UTSW 5 3968745 missense probably benign 0.04
R7284:Akap9 UTSW 5 3956246 missense probably damaging 1.00
R7299:Akap9 UTSW 5 4032696 missense probably damaging 1.00
R7313:Akap9 UTSW 5 4004933 missense probably damaging 1.00
U15987:Akap9 UTSW 5 4067924 critical splice donor site probably null
X0026:Akap9 UTSW 5 4014039 missense probably damaging 1.00
X0057:Akap9 UTSW 5 3975598 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- AAGAAGGTCAGAGCTGTTGTC -3'
(R):5'- GAACACTTCCGCTCGTTCTG -3'

Sequencing Primer
(F):5'- GTCATCAGTATCTGCATACACAAG -3'
(R):5'- CTGCTGAGAGTTGCCCAGTTC -3'
Posted On2017-01-03