Incidental Mutation 'R5697:Ctgf'
ID450746
Institutional Source Beutler Lab
Gene Symbol Ctgf
Ensembl Gene ENSMUSG00000019997
Gene Nameconnective tissue growth factor
SynonymsHcs24, Ccn2, Fisp12, hypertrophic chondrocyte-specific gene product 24
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5697 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location24595442-24598683 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 24597456 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 298 (T298A)
Ref Sequence ENSEMBL: ENSMUSP00000020171 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020171] [ENSMUST00000129142] [ENSMUST00000176228]
Predicted Effect probably benign
Transcript: ENSMUST00000020171
AA Change: T298A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000020171
Gene: ENSMUSG00000019997
AA Change: T298A

DomainStartEndE-ValueType
IB 26 96 1.45e-25 SMART
VWC 102 165 8.52e-22 SMART
TSP1 199 242 7.27e-7 SMART
CT 260 329 1.17e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125158
Predicted Effect probably benign
Transcript: ENSMUST00000129142
SMART Domains Protein: ENSMUSP00000135212
Gene: ENSMUSG00000019997

DomainStartEndE-ValueType
IB 3 73 1.45e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136908
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141076
Predicted Effect probably benign
Transcript: ENSMUST00000176228
SMART Domains Protein: ENSMUSP00000135147
Gene: ENSMUSG00000019997

DomainStartEndE-ValueType
IB 26 96 1.45e-25 SMART
VWC 102 165 8.52e-22 SMART
TSP1 199 242 7.27e-7 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a mitogen that is secreted by vascular endothelial cells. The encoded protein plays a role in chondrocyte proliferation and differentiation, cell adhesion in many cell types, and is related to platelet-derived growth factor. Certain polymorphisms in this gene have been linked with a higher incidence of systemic sclerosis. [provided by RefSeq, Nov 2009]
PHENOTYPE: Homozygous null mice die at birth from respiratory failure due to axial skeletal defects and pulmonary hypoplasia associated with reduced cell proliferation, enhanced apoptosis and altered pneumocyte maturation. Osteogenesis is impaired due to impaired chondrogenesis and growth plate angiogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr8 T C 14: 29,991,673 F550S possibly damaging Het
Adamts15 G A 9: 30,911,794 T326I probably damaging Het
Akap9 T C 5: 3,960,170 L309P possibly damaging Het
Arfgef1 T C 1: 10,160,838 M1149V probably benign Het
Atp6v0a4 C T 6: 38,050,507 probably null Het
Capn9 C T 8: 124,589,071 H39Y unknown Het
Celsr2 G A 3: 108,403,921 Q1425* probably null Het
Chd6 A G 2: 161,018,051 L610P probably damaging Het
Clasp2 A T 9: 113,860,122 T424S probably benign Het
Clec5a T C 6: 40,582,270 D35G probably benign Het
Dnhd1 T G 7: 105,674,188 V599G probably damaging Het
Enpep T C 3: 129,309,123 T395A probably benign Het
Evc2 G T 5: 37,370,608 L320F probably damaging Het
Fam129a T C 1: 151,700,261 F379L probably damaging Het
Gm14124 C T 2: 150,269,474 H695Y possibly damaging Het
Gm5346 A T 8: 43,626,579 W203R probably damaging Het
Hist1h2bp C T 13: 21,787,791 probably null Het
Hivep3 C T 4: 120,096,955 H823Y possibly damaging Het
Ighv1-59 C T 12: 115,335,348 E29K possibly damaging Het
Itsn1 A G 16: 91,801,589 I137V possibly damaging Het
Kntc1 A G 5: 123,765,007 T316A probably benign Het
Map4k5 T C 12: 69,830,436 T312A probably benign Het
Megf6 G T 4: 154,258,229 A642S probably null Het
Mrgprb3 G T 7: 48,642,925 L293M probably damaging Het
Nes A G 3: 87,977,848 E1138G probably damaging Het
Pias2 A G 18: 77,133,188 K373R probably damaging Het
Prss23 A G 7: 89,509,982 F293S probably damaging Het
Pzp A G 6: 128,525,189 Y66H probably benign Het
Rnf213 A G 11: 119,483,894 R5061G possibly damaging Het
Sergef A G 7: 46,639,259 probably benign Het
Slc7a1 A G 5: 148,333,982 V558A probably benign Het
Smc2 A G 4: 52,459,045 E480G probably benign Het
Smyd3 T G 1: 179,411,682 K111T probably damaging Het
Tchh A T 3: 93,445,043 R597* probably null Het
Ttc6 G T 12: 57,677,214 V1043L probably benign Het
Vmn1r10 T G 6: 57,113,489 L22R probably damaging Het
Vmn2r56 T C 7: 12,715,990 D107G probably damaging Het
Zfp365 A G 10: 67,909,640 Y103H probably benign Het
Zfp39 G T 11: 58,889,835 H700Q probably benign Het
Zfp982 A T 4: 147,512,589 E134D probably benign Het
Other mutations in Ctgf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02027:Ctgf APN 10 24596409 missense probably damaging 1.00
IGL02994:Ctgf APN 10 24596865 missense probably damaging 1.00
PIT4131001:Ctgf UTSW 10 24596090 missense probably damaging 0.97
R0443:Ctgf UTSW 10 24595803 splice site probably benign
R0496:Ctgf UTSW 10 24597515 missense possibly damaging 0.51
R0538:Ctgf UTSW 10 24596466 missense probably damaging 1.00
R1599:Ctgf UTSW 10 24597399 missense probably benign 0.08
R1721:Ctgf UTSW 10 24596797 missense probably damaging 1.00
R2095:Ctgf UTSW 10 24596479 missense probably benign 0.41
R2230:Ctgf UTSW 10 24596473 missense possibly damaging 0.61
R2322:Ctgf UTSW 10 24596834 missense probably damaging 1.00
R4913:Ctgf UTSW 10 24597327 missense probably damaging 1.00
R6705:Ctgf UTSW 10 24595955 missense probably damaging 0.99
R7067:Ctgf UTSW 10 24596975 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- GCTAGTCTACAAAGGCTTGAGG -3'
(R):5'- TAGTCTAATGAGTTCGTGTCCC -3'

Sequencing Primer
(F):5'- AGGCCACTCCCGTTGTAGTAATTG -3'
(R):5'- AATGAGTTCGTGTCCCTTACTTC -3'
Posted On2017-01-03