Incidental Mutation 'R5698:Krt14'
ID450807
Institutional Source Beutler Lab
Gene Symbol Krt14
Ensembl Gene ENSMUSG00000045545
Gene Namekeratin 14
SynonymsKrt1-14, K14, Cytokeratin 14, Krt-1.14, epidermolysis bullosa simplex, Dowling-Meara, Koebner
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5698 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location100203162-100207548 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 100205625 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 208 (T208A)
Ref Sequence ENSEMBL: ENSMUSP00000007272 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007272]
Predicted Effect probably benign
Transcript: ENSMUST00000007272
AA Change: T208A

PolyPhen 2 Score 0.435 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000007272
Gene: ENSMUSG00000045545
AA Change: T208A

DomainStartEndE-ValueType
low complexity region 10 29 N/A INTRINSIC
Filament 120 431 5.67e-176 SMART
low complexity region 433 450 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137265
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the keratin family, the most diverse group of intermediate filaments. This gene product, a type I keratin, is usually found as a heterotetramer with two keratin 5 molecules, a type II keratin. Together they form the cytoskeleton of epithelial cells. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for targeted null mutations develop extensive skin blistering after birth and die by 2 days of age. If keratin 16 is also expressed in skin, development is normal but later alopecia, chronic skin ulcers and stratified epithelial defects occur. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930556J24Rik A G 11: 3,976,366 K334E possibly damaging Het
Ache G A 5: 137,290,559 V176M probably damaging Het
Acss3 T C 10: 106,948,744 D539G probably damaging Het
Adam6b T A 12: 113,491,463 D633E probably benign Het
Aldh16a1 G A 7: 45,154,407 probably benign Het
Amigo2 G A 15: 97,245,726 Q272* probably null Het
Appbp2 A T 11: 85,210,099 H171Q probably damaging Het
Arhgef18 A G 8: 3,439,499 D277G probably damaging Het
Armc8 A G 9: 99,535,820 V95A probably benign Het
Atp6v0a4 C T 6: 38,050,507 probably null Het
Atp8a1 A T 5: 67,767,153 N289K probably benign Het
Cand2 C T 6: 115,791,743 L505F probably damaging Het
Ccnt2 A G 1: 127,803,228 K614R probably benign Het
Col25a1 A G 3: 130,478,983 probably null Het
Copa T A 1: 172,118,944 L976* probably null Het
Ddx39b T C 17: 35,251,311 V267A probably benign Het
Doxl2 A G 6: 48,976,322 T394A possibly damaging Het
Dpp4 T A 2: 62,334,311 Q709L probably damaging Het
Eno4 A G 19: 58,968,472 probably null Het
Exoc3 A G 13: 74,174,015 L647P probably benign Het
Eya4 T C 10: 23,140,077 S308G possibly damaging Het
Fbxo41 T C 6: 85,477,656 T693A possibly damaging Het
Fcgbp A G 7: 28,092,022 T903A possibly damaging Het
Fkbp10 G T 11: 100,423,526 W384L probably damaging Het
Frem2 A G 3: 53,652,505 I1527T possibly damaging Het
Gm14124 C T 2: 150,269,474 H695Y possibly damaging Het
H13 T A 2: 152,688,955 I220N probably damaging Het
Has2 T C 15: 56,667,916 R468G probably damaging Het
Ighmbp2 A G 19: 3,274,538 S243P probably damaging Het
Irs1 T C 1: 82,288,734 H587R probably benign Het
Kcnk1 C T 8: 126,025,405 T250M probably damaging Het
Kif9 T C 9: 110,510,464 V458A probably benign Het
Mybpc3 C A 2: 91,124,849 H349Q possibly damaging Het
Neurl3 T A 1: 36,266,506 T207S possibly damaging Het
Nol9 T C 4: 152,050,574 V388A probably damaging Het
Notch3 T C 17: 32,157,987 N315D probably damaging Het
Oas1h G T 5: 120,870,982 A252S probably damaging Het
Olfr156 C A 4: 43,821,183 M59I probably damaging Het
Pcbp1 G A 6: 86,525,152 T255M possibly damaging Het
Plec A G 15: 76,199,608 V18A probably benign Het
Ppp1r17 A T 6: 56,026,544 E114V probably damaging Het
Scamp5 A T 9: 57,445,433 M151K possibly damaging Het
Sestd1 T C 2: 77,218,168 Y135C possibly damaging Het
Slc22a21 T G 11: 53,951,349 K534N probably benign Het
Slc25a12 T C 2: 71,282,573 E448G probably damaging Het
Slco3a1 A G 7: 74,346,818 L280P probably damaging Het
Sppl2b C A 10: 80,866,045 probably null Het
Srd5a2 T C 17: 74,027,019 E135G possibly damaging Het
Tfg A T 16: 56,701,104 M183K probably damaging Het
Ticrr G A 7: 79,679,133 M673I probably benign Het
Tm4sf20 T G 1: 82,768,237 M61L probably benign Het
Ttll8 A T 15: 88,939,006 S85T possibly damaging Het
Uggt2 G A 14: 119,042,726 S780F probably damaging Het
Uroc1 T C 6: 90,347,320 L442P probably damaging Het
Znrf3 A G 11: 5,289,006 probably benign Het
Zswim2 C A 2: 83,925,183 D125Y possibly damaging Het
Other mutations in Krt14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01759:Krt14 APN 11 100204416 splice site probably benign
R0449:Krt14 UTSW 11 100207395 missense unknown
R0848:Krt14 UTSW 11 100204264 missense probably damaging 1.00
R1302:Krt14 UTSW 11 100203347 missense probably damaging 1.00
R2024:Krt14 UTSW 11 100207218 missense unknown
R2088:Krt14 UTSW 11 100204123 missense possibly damaging 0.81
R2161:Krt14 UTSW 11 100207113 missense unknown
R3878:Krt14 UTSW 11 100207089 missense possibly damaging 0.56
R5015:Krt14 UTSW 11 100207206 nonsense probably null
R5314:Krt14 UTSW 11 100204700 missense probably damaging 1.00
R5474:Krt14 UTSW 11 100204745 missense probably damaging 1.00
R5707:Krt14 UTSW 11 100204758 missense possibly damaging 0.77
R6072:Krt14 UTSW 11 100207166 missense unknown
R6523:Krt14 UTSW 11 100205097 missense possibly damaging 0.81
R6622:Krt14 UTSW 11 100203960 missense probably benign 0.00
R7082:Krt14 UTSW 11 100203341 missense possibly damaging 0.95
R7239:Krt14 UTSW 11 100204255 missense probably benign 0.03
R7350:Krt14 UTSW 11 100205100 nonsense probably null
X0020:Krt14 UTSW 11 100205106 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GCTGTGGATCACAATCTCCTAG -3'
(R):5'- GCTGTGGGAAACAAAGGCTC -3'

Sequencing Primer
(F):5'- GGATCACAATCTCCTAGGTAACTGG -3'
(R):5'- GAACAGGATTCAAGCAAGAGC -3'
Posted On2017-01-03