Incidental Mutation 'R5700:Grid2'
ID 450840
Institutional Source Beutler Lab
Gene Symbol Grid2
Ensembl Gene ENSMUSG00000071424
Gene Name glutamate receptor, ionotropic, delta 2
Synonyms tpr, B230104L07Rik, GluRdelta2
MMRRC Submission 043328-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5700 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 63232860-64681307 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 64071416 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Aspartic acid at position 413 (V413D)
Ref Sequence ENSEMBL: ENSMUSP00000093536 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095852]
AlphaFold Q61625
Predicted Effect possibly damaging
Transcript: ENSMUST00000095852
AA Change: V413D

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000093536
Gene: ENSMUSG00000071424
AA Change: V413D

DomainStartEndE-ValueType
Pfam:ANF_receptor 39 404 4.1e-41 PFAM
PBPe 442 807 5.98e-108 SMART
Lig_chan-Glu_bd 452 514 3.76e-24 SMART
transmembrane domain 830 852 N/A INTRINSIC
low complexity region 945 956 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159561
SMART Domains Protein: ENSMUSP00000125402
Gene: ENSMUSG00000071424

DomainStartEndE-ValueType
Pfam:ANF_receptor 39 404 2.7e-36 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161105
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162968
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203031
Meta Mutation Damage Score 0.4153 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the family of ionotropic glutamate receptors which are the predominant excitatory neurotransmitter receptors in the mammalian brain. The encoded protein is a multi-pass membrane protein that is expressed selectively in cerebellar Purkinje cells. A point mutation in the mouse ortholog, associated with the phenotype named 'lurcher', in the heterozygous state leads to ataxia resulting from selective, cell-autonomous apoptosis of cerebellar Purkinje cells during postnatal development. Mice homozygous for this mutation die shortly after birth from massive loss of mid- and hindbrain neurons during late embryogenesis. This protein also plays a role in synapse organization between parallel fibers and Purkinje cells. Alternate splicing results in multiple transcript variants encoding distinct isoforms. Mutations in this gene cause cerebellar ataxia in humans. [provided by RefSeq, Apr 2014]
PHENOTYPE: Homozygotes for multiple spontaneous and targeted null mutations exhibit ataxia and impaired locomotion associated with cerebellar Purkinje cell abnormalities and loss, and on some backgrounds, male infertility due to lack of zona penetration by sperm. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 A T 19: 43,786,633 (GRCm39) Q155L probably benign Het
Acadvl A C 11: 69,904,029 (GRCm39) Y242D probably damaging Het
Armc8 A G 9: 99,378,202 (GRCm39) probably null Het
Barx2 A T 9: 31,770,061 (GRCm39) F156I probably damaging Het
Best1 T C 19: 9,974,563 (GRCm39) probably benign Het
Btbd8 T C 5: 107,651,514 (GRCm39) S136P possibly damaging Het
Btla T A 16: 45,070,936 (GRCm39) Y298* probably null Het
Casr T A 16: 36,329,979 (GRCm39) I452F probably damaging Het
Ccser1 C A 6: 61,288,260 (GRCm39) P141H probably benign Het
Cr2 A G 1: 194,842,065 (GRCm39) V296A probably damaging Het
Csl T A 10: 99,594,877 (GRCm39) I63F probably damaging Het
Dbt G A 3: 116,313,952 (GRCm39) V40M probably damaging Het
Fam53b A T 7: 132,361,749 (GRCm39) L93Q probably damaging Het
Fdps T C 3: 89,002,956 (GRCm39) I105V probably damaging Het
Gm4884 A G 7: 40,692,643 (GRCm39) D204G probably benign Het
Gm5592 A G 7: 40,808,003 (GRCm39) probably benign Het
Gm7367 A T 7: 59,805,510 (GRCm39) noncoding transcript Het
Hgf C T 5: 16,815,122 (GRCm39) P471L probably damaging Het
Hoxc9 T C 15: 102,890,313 (GRCm39) Y77H possibly damaging Het
Hs6st3 C T 14: 119,376,199 (GRCm39) R125* probably null Het
Kdm4b T C 17: 56,658,700 (GRCm39) I15T possibly damaging Het
Klhl1 T C 14: 96,755,476 (GRCm39) N93S probably benign Het
Klhl6 G A 16: 19,775,968 (GRCm39) Q197* probably null Het
Medag T C 5: 149,345,682 (GRCm39) V7A probably benign Het
Mptx2 G A 1: 173,102,414 (GRCm39) L92F probably benign Het
Nckap5 C T 1: 125,904,662 (GRCm39) probably null Het
Obscn T C 11: 59,024,020 (GRCm39) K550R probably benign Het
Or2d36 A G 7: 106,746,748 (GRCm39) N75S probably benign Het
Or2w1b T A 13: 21,300,171 (GRCm39) V103E probably damaging Het
Or5h25 T A 16: 58,930,356 (GRCm39) I206F probably damaging Het
Or7a42 T C 10: 78,791,318 (GRCm39) I93T probably damaging Het
Parp6 T C 9: 59,532,010 (GRCm39) S101P probably damaging Het
Plcd3 T C 11: 102,964,589 (GRCm39) N594S probably benign Het
Plscr5 A T 9: 92,087,564 (GRCm39) K178* probably null Het
Ppp2r1b T C 9: 50,789,457 (GRCm39) Y443H probably damaging Het
Prnd G A 2: 131,795,263 (GRCm39) V128I probably benign Het
Rftn1 G T 17: 50,309,697 (GRCm39) P156Q probably damaging Het
Scmh1 T C 4: 120,374,143 (GRCm39) V445A probably benign Het
Serpinb6c A T 13: 34,083,291 (GRCm39) M41K probably damaging Het
Slc66a1 C T 4: 139,027,565 (GRCm39) S259N probably damaging Het
Spns1 A G 7: 125,971,641 (GRCm39) V303A possibly damaging Het
Ston1 T A 17: 88,951,767 (GRCm39) S639R probably damaging Het
Thbs4 T C 13: 92,913,461 (GRCm39) D153G probably benign Het
Timm44 T C 8: 4,324,171 (GRCm39) Y36C probably damaging Het
Trim34b G T 7: 103,985,618 (GRCm39) V418F probably damaging Het
Vmn1r72 C T 7: 11,404,350 (GRCm39) V33M probably damaging Het
Zcchc7 T C 4: 44,931,084 (GRCm39) V412A probably benign Het
Zfand1 T A 3: 10,406,079 (GRCm39) N210I probably damaging Het
Zfhx3 A G 8: 109,660,499 (GRCm39) H1251R probably damaging Het
Other mutations in Grid2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00580:Grid2 APN 6 64,322,573 (GRCm39) missense probably damaging 1.00
IGL00596:Grid2 APN 6 64,510,688 (GRCm39) missense possibly damaging 0.93
IGL01686:Grid2 APN 6 64,297,180 (GRCm39) missense probably benign 0.00
IGL01712:Grid2 APN 6 64,642,899 (GRCm39) missense possibly damaging 0.73
IGL02064:Grid2 APN 6 64,040,919 (GRCm39) missense probably benign 0.29
IGL02216:Grid2 APN 6 64,322,650 (GRCm39) missense probably damaging 0.96
IGL02563:Grid2 APN 6 64,322,857 (GRCm39) missense possibly damaging 0.94
IGL02685:Grid2 APN 6 64,322,800 (GRCm39) missense possibly damaging 0.50
IGL03129:Grid2 APN 6 64,040,888 (GRCm39) missense probably damaging 0.98
IGL03324:Grid2 APN 6 64,406,806 (GRCm39) missense possibly damaging 0.88
IGL03395:Grid2 APN 6 63,886,053 (GRCm39) missense possibly damaging 0.94
crawler UTSW 6 64,406,678 (GRCm39) nonsense probably null
swagger UTSW 6 64,372,263 (GRCm39) synonymous probably benign
R0133:Grid2 UTSW 6 64,297,116 (GRCm39) missense probably damaging 1.00
R0147:Grid2 UTSW 6 64,510,571 (GRCm39) missense probably benign
R0193:Grid2 UTSW 6 64,040,937 (GRCm39) missense possibly damaging 0.64
R0370:Grid2 UTSW 6 64,322,718 (GRCm39) missense possibly damaging 0.75
R0399:Grid2 UTSW 6 64,643,036 (GRCm39) missense probably benign 0.33
R0600:Grid2 UTSW 6 63,480,419 (GRCm39) missense probably benign 0.38
R0717:Grid2 UTSW 6 64,643,259 (GRCm39) missense possibly damaging 0.96
R1524:Grid2 UTSW 6 64,406,738 (GRCm39) missense possibly damaging 0.92
R1555:Grid2 UTSW 6 64,406,668 (GRCm39) missense possibly damaging 0.87
R1572:Grid2 UTSW 6 64,406,678 (GRCm39) nonsense probably null
R1762:Grid2 UTSW 6 64,510,638 (GRCm39) missense probably damaging 0.98
R1944:Grid2 UTSW 6 63,886,045 (GRCm39) missense probably damaging 1.00
R1961:Grid2 UTSW 6 63,885,877 (GRCm39) missense probably damaging 1.00
R1969:Grid2 UTSW 6 63,885,902 (GRCm39) nonsense probably null
R2138:Grid2 UTSW 6 64,322,782 (GRCm39) missense probably damaging 0.99
R3500:Grid2 UTSW 6 63,480,383 (GRCm39) missense probably damaging 0.97
R3547:Grid2 UTSW 6 64,297,005 (GRCm39) missense probably damaging 0.97
R3845:Grid2 UTSW 6 64,322,826 (GRCm39) missense possibly damaging 0.62
R4124:Grid2 UTSW 6 63,480,417 (GRCm39) missense probably benign 0.41
R4273:Grid2 UTSW 6 63,886,029 (GRCm39) missense probably damaging 1.00
R4591:Grid2 UTSW 6 64,297,086 (GRCm39) missense probably damaging 1.00
R4701:Grid2 UTSW 6 64,642,899 (GRCm39) missense probably benign 0.27
R4721:Grid2 UTSW 6 64,643,185 (GRCm39) missense probably benign 0.33
R4755:Grid2 UTSW 6 63,885,972 (GRCm39) missense probably benign 0.04
R4869:Grid2 UTSW 6 64,406,724 (GRCm39) missense probably damaging 1.00
R5083:Grid2 UTSW 6 64,297,136 (GRCm39) nonsense probably null
R5091:Grid2 UTSW 6 64,053,862 (GRCm39) missense probably benign 0.07
R5117:Grid2 UTSW 6 63,233,917 (GRCm39) missense probably benign 0.15
R5128:Grid2 UTSW 6 64,642,982 (GRCm39) missense probably benign 0.01
R5386:Grid2 UTSW 6 63,908,089 (GRCm39) missense probably damaging 0.99
R5404:Grid2 UTSW 6 63,907,894 (GRCm39) missense probably damaging 0.99
R5534:Grid2 UTSW 6 63,480,345 (GRCm39) missense probably benign
R5626:Grid2 UTSW 6 64,053,929 (GRCm39) critical splice donor site probably null
R5699:Grid2 UTSW 6 63,885,975 (GRCm39) missense probably damaging 0.99
R5876:Grid2 UTSW 6 64,640,146 (GRCm39) missense probably damaging 1.00
R6446:Grid2 UTSW 6 64,322,577 (GRCm39) missense probably damaging 1.00
R6694:Grid2 UTSW 6 63,908,031 (GRCm39) missense possibly damaging 0.92
R6697:Grid2 UTSW 6 63,908,031 (GRCm39) missense possibly damaging 0.92
R6699:Grid2 UTSW 6 63,908,031 (GRCm39) missense possibly damaging 0.92
R6767:Grid2 UTSW 6 63,907,999 (GRCm39) missense probably benign 0.01
R6895:Grid2 UTSW 6 64,372,283 (GRCm39) missense probably damaging 0.99
R6999:Grid2 UTSW 6 64,053,893 (GRCm39) missense possibly damaging 0.80
R7053:Grid2 UTSW 6 64,677,402 (GRCm39) missense unknown
R7126:Grid2 UTSW 6 64,053,794 (GRCm39) missense probably damaging 0.99
R7432:Grid2 UTSW 6 64,252,854 (GRCm39) missense possibly damaging 0.46
R7553:Grid2 UTSW 6 64,053,925 (GRCm39) missense possibly damaging 0.95
R7619:Grid2 UTSW 6 63,908,085 (GRCm39) missense possibly damaging 0.71
R7997:Grid2 UTSW 6 64,297,120 (GRCm39) missense possibly damaging 0.89
R8112:Grid2 UTSW 6 63,885,891 (GRCm39) missense probably damaging 0.99
R8296:Grid2 UTSW 6 63,233,929 (GRCm39) critical splice donor site probably null
R8320:Grid2 UTSW 6 63,233,917 (GRCm39) missense probably benign 0.15
R8467:Grid2 UTSW 6 64,510,635 (GRCm39) missense probably benign 0.01
R8691:Grid2 UTSW 6 63,480,321 (GRCm39) missense probably damaging 0.97
R8890:Grid2 UTSW 6 63,233,923 (GRCm39) missense probably benign
R8965:Grid2 UTSW 6 64,296,990 (GRCm39) missense probably damaging 1.00
R8968:Grid2 UTSW 6 64,643,139 (GRCm39) missense probably benign 0.14
R9220:Grid2 UTSW 6 63,885,888 (GRCm39) missense probably damaging 1.00
R9371:Grid2 UTSW 6 64,677,506 (GRCm39) missense unknown
R9653:Grid2 UTSW 6 63,907,968 (GRCm39) missense possibly damaging 0.75
Z1176:Grid2 UTSW 6 64,640,212 (GRCm39) missense probably benign 0.03
Z1176:Grid2 UTSW 6 63,885,863 (GRCm39) missense possibly damaging 0.76
Z1177:Grid2 UTSW 6 64,322,841 (GRCm39) missense probably damaging 1.00
Z1177:Grid2 UTSW 6 64,322,840 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACTCCTGGGTGTATTGTTCATCTAC -3'
(R):5'- GGGAAGCACTATGTTATTTCTCTTCAG -3'

Sequencing Primer
(F):5'- TTCCCTCATCTAGGGTGGA -3'
(R):5'- TGTCTAAGGAGTGCTCTC -3'
Posted On 2017-01-03