Incidental Mutation 'R5701:Gpr158'
ID450876
Institutional Source Beutler Lab
Gene Symbol Gpr158
Ensembl Gene ENSMUSG00000045967
Gene NameG protein-coupled receptor 158
Synonyms5330427M13Rik
MMRRC Submission 043181-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R5701 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location21367542-21830547 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 21746709 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 480 (R480C)
Ref Sequence ENSEMBL: ENSMUSP00000049708 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055946]
Predicted Effect probably damaging
Transcript: ENSMUST00000055946
AA Change: R480C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000049708
Gene: ENSMUSG00000045967
AA Change: R480C

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 110 125 N/A INTRINSIC
SCOP:d1edmb_ 313 359 5e-4 SMART
Blast:EGF 318 365 2e-27 BLAST
Pfam:7tm_3 426 669 1.2e-35 PFAM
low complexity region 840 863 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155760
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T A 3: 36,921,360 M727K probably benign Het
Armc8 A G 9: 99,496,149 probably null Het
Asxl1 A G 2: 153,399,489 E653G probably damaging Het
AW551984 G A 9: 39,592,822 A616V probably benign Het
Birc6 T C 17: 74,697,425 M4763T possibly damaging Het
Cand2 T G 6: 115,797,932 F1034V probably damaging Het
Ccdc80 T C 16: 45,116,378 V722A possibly damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Chrnd G A 1: 87,197,658 V340I possibly damaging Het
Clip1 T C 5: 123,613,303 probably benign Het
Csmd3 T C 15: 47,650,221 E1920G probably damaging Het
Csmd3 A T 15: 48,540,333 F194I probably damaging Het
D930048N14Rik T A 11: 51,653,729 probably null Het
Defa28 T C 8: 21,583,847 Y89H probably benign Het
Dnah1 C T 14: 31,274,044 G2705E probably damaging Het
Eci2 A T 13: 34,990,267 S104T possibly damaging Het
Ep300 T C 15: 81,601,495 S228P unknown Het
Gabrb2 T A 11: 42,487,374 M139K probably damaging Het
Gbp4 T A 5: 105,118,399 N592I possibly damaging Het
Gps1 A G 11: 120,785,182 D71G probably benign Het
Hoxc9 T C 15: 102,981,881 Y77H possibly damaging Het
Il9r T A 11: 32,193,263 Y231F probably benign Het
Klhl1 A G 14: 96,201,380 M494T probably benign Het
Kmt2c A G 5: 25,314,017 V2365A probably benign Het
Kri1 T A 9: 21,281,129 K241M possibly damaging Het
Macf1 A T 4: 123,503,225 C928S probably damaging Het
Mcm2 T C 6: 88,893,091 D32G probably damaging Het
Mex3d T C 10: 80,381,545 T613A probably benign Het
Mptx2 G A 1: 173,274,847 L92F probably benign Het
Myh9 T C 15: 77,791,764 I241V probably benign Het
Myo6 C T 9: 80,258,527 T398I probably damaging Het
Nckap1l G A 15: 103,472,768 A366T probably benign Het
Olfr1028 A G 2: 85,951,824 T254A possibly damaging Het
Plscr5 A T 9: 92,205,511 K178* probably null Het
Pqlc1 T A 18: 80,272,478 D118E possibly damaging Het
Rapgef6 T C 11: 54,676,394 W857R possibly damaging Het
Raxos1 G A 18: 65,937,988 probably benign Het
Rnf145 G A 11: 44,531,293 V68M possibly damaging Het
Synpo2 C G 3: 123,080,230 G1029A probably damaging Het
Tbc1d5 TTGCTGCTGCTGCTGCTGCTGGTGCTGCTGCTGCTG TTGCTGCTGCTGCTGCTGGTGCTGCTGCTGCTG 17: 50,799,955 probably benign Het
Vmn2r14 T C 5: 109,219,950 Y392C probably damaging Het
Vmn2r55 A G 7: 12,670,565 F304L probably benign Het
Zfp316 C T 5: 143,254,377 G629D probably benign Het
Other mutations in Gpr158
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Gpr158 APN 2 21368683 missense probably damaging 1.00
IGL00469:Gpr158 APN 2 21746795 splice site probably benign
IGL00706:Gpr158 APN 2 21746773 missense probably damaging 1.00
IGL00780:Gpr158 APN 2 21826818 nonsense probably null
IGL00885:Gpr158 APN 2 21649021 missense probably damaging 1.00
IGL01339:Gpr158 APN 2 21369031 missense possibly damaging 0.73
IGL01368:Gpr158 APN 2 21827098 missense probably damaging 1.00
IGL02141:Gpr158 APN 2 21783290 missense probably damaging 0.99
IGL02455:Gpr158 APN 2 21368700 missense probably benign 0.00
IGL02554:Gpr158 APN 2 21826596 missense probably benign
IGL02681:Gpr158 APN 2 21815630 missense probably damaging 1.00
IGL02752:Gpr158 APN 2 21826827 missense possibly damaging 0.95
IGL02756:Gpr158 APN 2 21827079 missense possibly damaging 0.47
IGL03181:Gpr158 APN 2 21783161 missense probably benign 0.02
IGL03258:Gpr158 APN 2 21825274 missense probably damaging 1.00
IGL03386:Gpr158 APN 2 21826246 missense probably damaging 1.00
R0071:Gpr158 UTSW 2 21810668 missense probably benign 0.08
R0081:Gpr158 UTSW 2 21826717 missense probably damaging 1.00
R0528:Gpr158 UTSW 2 21825208 missense probably damaging 1.00
R0560:Gpr158 UTSW 2 21825274 missense probably damaging 1.00
R0603:Gpr158 UTSW 2 21815669 missense possibly damaging 0.67
R1560:Gpr158 UTSW 2 21826314 missense probably damaging 1.00
R1561:Gpr158 UTSW 2 21815694 splice site probably null
R1609:Gpr158 UTSW 2 21783293 missense possibly damaging 0.61
R1741:Gpr158 UTSW 2 21827548 missense probably benign 0.00
R1827:Gpr158 UTSW 2 21827318 missense probably benign
R1854:Gpr158 UTSW 2 21369124 missense probably damaging 1.00
R1871:Gpr158 UTSW 2 21815615 missense probably damaging 1.00
R2151:Gpr158 UTSW 2 21827514 missense possibly damaging 0.82
R2273:Gpr158 UTSW 2 21826863 missense probably benign
R2275:Gpr158 UTSW 2 21826863 missense probably benign
R3004:Gpr158 UTSW 2 21826999 missense probably damaging 0.99
R3151:Gpr158 UTSW 2 21576960 missense possibly damaging 0.68
R3943:Gpr158 UTSW 2 21368559 missense possibly damaging 0.65
R4238:Gpr158 UTSW 2 21368551 missense probably damaging 1.00
R4379:Gpr158 UTSW 2 21825214 missense probably damaging 1.00
R4381:Gpr158 UTSW 2 21827592 missense probably damaging 1.00
R4464:Gpr158 UTSW 2 21826999 missense probably damaging 0.99
R4467:Gpr158 UTSW 2 21826999 missense probably damaging 0.99
R4496:Gpr158 UTSW 2 21826999 missense probably damaging 0.99
R4506:Gpr158 UTSW 2 21826999 missense probably damaging 0.99
R4530:Gpr158 UTSW 2 21369000 missense probably benign 0.03
R4646:Gpr158 UTSW 2 21827053 missense probably benign
R4798:Gpr158 UTSW 2 21783182 missense probably damaging 1.00
R4882:Gpr158 UTSW 2 21825248 missense probably damaging 0.98
R4943:Gpr158 UTSW 2 21827157 missense probably damaging 1.00
R5334:Gpr158 UTSW 2 21827505 missense probably benign 0.01
R5560:Gpr158 UTSW 2 21826290 missense possibly damaging 0.67
R5600:Gpr158 UTSW 2 21827235 missense probably benign
R5637:Gpr158 UTSW 2 21783272 missense probably benign 0.00
R5744:Gpr158 UTSW 2 21368520 missense probably damaging 1.00
R5911:Gpr158 UTSW 2 21369121 missense possibly damaging 0.95
R5991:Gpr158 UTSW 2 21368508 missense probably damaging 0.99
R6200:Gpr158 UTSW 2 21399416 missense probably damaging 0.97
R6306:Gpr158 UTSW 2 21815611 missense possibly damaging 0.84
R6324:Gpr158 UTSW 2 21810554 missense probably damaging 1.00
R6384:Gpr158 UTSW 2 21826288 missense probably damaging 1.00
R6698:Gpr158 UTSW 2 21827110 missense probably damaging 1.00
X0062:Gpr158 UTSW 2 21826369 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTACAGACTTGGAAACGTGATC -3'
(R):5'- ACATTGTTGAATAATGGCCAGC -3'

Sequencing Primer
(F):5'- GAGTGATCCTGTAGTTCCTCAGC -3'
(R):5'- TGGCCAGCTCAGTTTACAAC -3'
Posted On2017-01-03