Incidental Mutation 'R5701:Mex3d'
ID450897
Institutional Source Beutler Lab
Gene Symbol Mex3d
Ensembl Gene ENSMUSG00000048696
Gene Namemex3 RNA binding family member D
SynonymsRkhd1
MMRRC Submission 043181-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.273) question?
Stock #R5701 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location80380355-80387659 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 80381545 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 613 (T613A)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105350]
Predicted Effect probably benign
Transcript: ENSMUST00000062946
AA Change: T613A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000057962
Gene: ENSMUSG00000048696
AA Change: T613A

DomainStartEndE-ValueType
low complexity region 5 27 N/A INTRINSIC
low complexity region 30 65 N/A INTRINSIC
internal_repeat_1 88 132 4.63e-12 PROSPERO
internal_repeat_1 130 174 4.63e-12 PROSPERO
low complexity region 185 201 N/A INTRINSIC
KH 232 300 6.8e-10 SMART
KH 327 394 4.45e-14 SMART
low complexity region 463 495 N/A INTRINSIC
low complexity region 570 585 N/A INTRINSIC
low complexity region 606 631 N/A INTRINSIC
low complexity region 642 664 N/A INTRINSIC
RING 667 706 7.34e-3 SMART
Predicted Effect unknown
Transcript: ENSMUST00000105350
AA Change: T613A
SMART Domains Protein: ENSMUSP00000100987
Gene: ENSMUSG00000048696
AA Change: T613A

DomainStartEndE-ValueType
internal_repeat_2 3 25 3.12e-8 PROSPERO
internal_repeat_1 5 34 7.48e-13 PROSPERO
internal_repeat_1 41 70 7.48e-13 PROSPERO
internal_repeat_2 51 73 3.12e-8 PROSPERO
low complexity region 78 94 N/A INTRINSIC
KH 125 193 6.8e-10 SMART
KH 220 287 4.45e-14 SMART
low complexity region 356 388 N/A INTRINSIC
low complexity region 463 478 N/A INTRINSIC
low complexity region 499 524 N/A INTRINSIC
low complexity region 535 557 N/A INTRINSIC
RING 560 599 7.34e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122709
Predicted Effect unknown
Transcript: ENSMUST00000123141
AA Change: T148A
SMART Domains Protein: ENSMUSP00000115410
Gene: ENSMUSG00000048696
AA Change: T148A

DomainStartEndE-ValueType
low complexity region 2 31 N/A INTRINSIC
low complexity region 106 121 N/A INTRINSIC
low complexity region 142 167 N/A INTRINSIC
low complexity region 178 200 N/A INTRINSIC
RING 203 242 7.34e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218129
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T A 3: 36,921,360 M727K probably benign Het
Armc8 A G 9: 99,496,149 probably null Het
Asxl1 A G 2: 153,399,489 E653G probably damaging Het
AW551984 G A 9: 39,592,822 A616V probably benign Het
Birc6 T C 17: 74,697,425 M4763T possibly damaging Het
Cand2 T G 6: 115,797,932 F1034V probably damaging Het
Ccdc80 T C 16: 45,116,378 V722A possibly damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Chrnd G A 1: 87,197,658 V340I possibly damaging Het
Clip1 T C 5: 123,613,303 probably benign Het
Csmd3 T C 15: 47,650,221 E1920G probably damaging Het
Csmd3 A T 15: 48,540,333 F194I probably damaging Het
D930048N14Rik T A 11: 51,653,729 probably null Het
Defa28 T C 8: 21,583,847 Y89H probably benign Het
Dnah1 C T 14: 31,274,044 G2705E probably damaging Het
Eci2 A T 13: 34,990,267 S104T possibly damaging Het
Ep300 T C 15: 81,601,495 S228P unknown Het
Gabrb2 T A 11: 42,487,374 M139K probably damaging Het
Gbp4 T A 5: 105,118,399 N592I possibly damaging Het
Gpr158 C T 2: 21,746,709 R480C probably damaging Het
Gps1 A G 11: 120,785,182 D71G probably benign Het
Hoxc9 T C 15: 102,981,881 Y77H possibly damaging Het
Il9r T A 11: 32,193,263 Y231F probably benign Het
Klhl1 A G 14: 96,201,380 M494T probably benign Het
Kmt2c A G 5: 25,314,017 V2365A probably benign Het
Kri1 T A 9: 21,281,129 K241M possibly damaging Het
Macf1 A T 4: 123,503,225 C928S probably damaging Het
Mcm2 T C 6: 88,893,091 D32G probably damaging Het
Mptx2 G A 1: 173,274,847 L92F probably benign Het
Myh9 T C 15: 77,791,764 I241V probably benign Het
Myo6 C T 9: 80,258,527 T398I probably damaging Het
Nckap1l G A 15: 103,472,768 A366T probably benign Het
Olfr1028 A G 2: 85,951,824 T254A possibly damaging Het
Plscr5 A T 9: 92,205,511 K178* probably null Het
Pqlc1 T A 18: 80,272,478 D118E possibly damaging Het
Rapgef6 T C 11: 54,676,394 W857R possibly damaging Het
Raxos1 G A 18: 65,937,988 probably benign Het
Rnf145 G A 11: 44,531,293 V68M possibly damaging Het
Synpo2 C G 3: 123,080,230 G1029A probably damaging Het
Tbc1d5 TTGCTGCTGCTGCTGCTGCTGGTGCTGCTGCTGCTG TTGCTGCTGCTGCTGCTGGTGCTGCTGCTGCTG 17: 50,799,955 probably benign Het
Vmn2r14 T C 5: 109,219,950 Y392C probably damaging Het
Vmn2r55 A G 7: 12,670,565 F304L probably benign Het
Zfp316 C T 5: 143,254,377 G629D probably benign Het
Other mutations in Mex3d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01554:Mex3d APN 10 80382035 missense possibly damaging 0.49
R0316:Mex3d UTSW 10 80381671 missense probably damaging 0.97
R0401:Mex3d UTSW 10 80386894 missense probably benign 0.33
R0734:Mex3d UTSW 10 80381532 missense possibly damaging 0.55
R0894:Mex3d UTSW 10 80381542 missense probably benign 0.04
R1452:Mex3d UTSW 10 80381520 missense probably damaging 0.99
R1764:Mex3d UTSW 10 80386936 missense probably benign 0.15
R1795:Mex3d UTSW 10 80381542 missense probably benign 0.04
R4801:Mex3d UTSW 10 80386954 missense possibly damaging 0.77
R4802:Mex3d UTSW 10 80386954 missense possibly damaging 0.77
R5632:Mex3d UTSW 10 80382594 missense probably damaging 1.00
R5964:Mex3d UTSW 10 80382587 missense probably damaging 1.00
R6133:Mex3d UTSW 10 80386786 missense probably damaging 0.99
R6414:Mex3d UTSW 10 80381371 missense unknown
R6938:Mex3d UTSW 10 80382240 missense possibly damaging 0.61
R7154:Mex3d UTSW 10 80386750 missense
R7241:Mex3d UTSW 10 80387257 missense
Predicted Primers PCR Primer
(F):5'- TGGCCTCACCTTCAGAACAC -3'
(R):5'- TTTGACTTCCTGGCGCTAGAC -3'

Sequencing Primer
(F):5'- GAACACACCACACACTCTCGAG -3'
(R):5'- TGCCACGGCTACCATTTGG -3'
Posted On2017-01-03