Incidental Mutation 'R5701:Tbc1d5'
ID450915
Institutional Source Beutler Lab
Gene Symbol Tbc1d5
Ensembl Gene ENSMUSG00000023923
Gene NameTBC1 domain family, member 5
Synonyms1600014N05Rik
MMRRC Submission 043181-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.152) question?
Stock #R5701 (G1)
Quality Score102
Status Not validated
Chromosome17
Chromosomal Location50733124-51179352 bp(-) (GRCm38)
Type of Mutationsmall deletion (1 aa in frame mutation)
DNA Base Change (assembly) TTGCTGCTGCTGCTGCTGCTGGTGCTGCTGCTGCTG to TTGCTGCTGCTGCTGCTGGTGCTGCTGCTGCTG at 50799955 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000153172 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024717] [ENSMUST00000224528]
Predicted Effect probably benign
Transcript: ENSMUST00000024717
SMART Domains Protein: ENSMUSP00000024717
Gene: ENSMUSG00000023923

DomainStartEndE-ValueType
TBC 78 384 5.56e-86 SMART
low complexity region 475 492 N/A INTRINSIC
SCOP:d1lsha3 511 546 1e-3 SMART
low complexity region 556 568 N/A INTRINSIC
low complexity region 783 802 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000224528
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224977
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225252
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T A 3: 36,921,360 M727K probably benign Het
Armc8 A G 9: 99,496,149 probably null Het
Asxl1 A G 2: 153,399,489 E653G probably damaging Het
AW551984 G A 9: 39,592,822 A616V probably benign Het
Birc6 T C 17: 74,697,425 M4763T possibly damaging Het
Cand2 T G 6: 115,797,932 F1034V probably damaging Het
Ccdc80 T C 16: 45,116,378 V722A possibly damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Chrnd G A 1: 87,197,658 V340I possibly damaging Het
Clip1 T C 5: 123,613,303 probably benign Het
Csmd3 T C 15: 47,650,221 E1920G probably damaging Het
Csmd3 A T 15: 48,540,333 F194I probably damaging Het
D930048N14Rik T A 11: 51,653,729 probably null Het
Defa28 T C 8: 21,583,847 Y89H probably benign Het
Dnah1 C T 14: 31,274,044 G2705E probably damaging Het
Eci2 A T 13: 34,990,267 S104T possibly damaging Het
Ep300 T C 15: 81,601,495 S228P unknown Het
Gabrb2 T A 11: 42,487,374 M139K probably damaging Het
Gbp4 T A 5: 105,118,399 N592I possibly damaging Het
Gpr158 C T 2: 21,746,709 R480C probably damaging Het
Gps1 A G 11: 120,785,182 D71G probably benign Het
Hoxc9 T C 15: 102,981,881 Y77H possibly damaging Het
Il9r T A 11: 32,193,263 Y231F probably benign Het
Klhl1 A G 14: 96,201,380 M494T probably benign Het
Kmt2c A G 5: 25,314,017 V2365A probably benign Het
Kri1 T A 9: 21,281,129 K241M possibly damaging Het
Macf1 A T 4: 123,503,225 C928S probably damaging Het
Mcm2 T C 6: 88,893,091 D32G probably damaging Het
Mex3d T C 10: 80,381,545 T613A probably benign Het
Mptx2 G A 1: 173,274,847 L92F probably benign Het
Myh9 T C 15: 77,791,764 I241V probably benign Het
Myo6 C T 9: 80,258,527 T398I probably damaging Het
Nckap1l G A 15: 103,472,768 A366T probably benign Het
Olfr1028 A G 2: 85,951,824 T254A possibly damaging Het
Plscr5 A T 9: 92,205,511 K178* probably null Het
Pqlc1 T A 18: 80,272,478 D118E possibly damaging Het
Rapgef6 T C 11: 54,676,394 W857R possibly damaging Het
Raxos1 G A 18: 65,937,988 probably benign Het
Rnf145 G A 11: 44,531,293 V68M possibly damaging Het
Synpo2 C G 3: 123,080,230 G1029A probably damaging Het
Vmn2r14 T C 5: 109,219,950 Y392C probably damaging Het
Vmn2r55 A G 7: 12,670,565 F304L probably benign Het
Zfp316 C T 5: 143,254,377 G629D probably benign Het
Other mutations in Tbc1d5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01287:Tbc1d5 APN 17 50813798 missense possibly damaging 0.52
IGL01370:Tbc1d5 APN 17 50966727 missense probably benign 0.18
IGL01625:Tbc1d5 APN 17 50917573 missense probably benign 0.27
IGL01935:Tbc1d5 APN 17 50963765 splice site probably benign
IGL02229:Tbc1d5 APN 17 50852600 missense probably damaging 1.00
IGL02811:Tbc1d5 APN 17 50800121 missense probably damaging 0.99
IGL03192:Tbc1d5 APN 17 50984681 splice site probably benign
FR4976:Tbc1d5 UTSW 17 50799931 missense probably benign
FR4976:Tbc1d5 UTSW 17 50799943 missense probably benign 0.01
IGL02796:Tbc1d5 UTSW 17 50966624 missense probably damaging 1.00
R0153:Tbc1d5 UTSW 17 50984687 splice site probably benign
R0326:Tbc1d5 UTSW 17 50966736 missense probably damaging 1.00
R0417:Tbc1d5 UTSW 17 50756705 missense probably benign 0.18
R0481:Tbc1d5 UTSW 17 50919051 missense probably damaging 0.98
R1143:Tbc1d5 UTSW 17 50742059 nonsense probably null
R1533:Tbc1d5 UTSW 17 50920575 missense possibly damaging 0.89
R1543:Tbc1d5 UTSW 17 50935532 missense probably benign 0.32
R2888:Tbc1d5 UTSW 17 50935549 missense probably damaging 1.00
R3153:Tbc1d5 UTSW 17 50968236 missense probably damaging 1.00
R3430:Tbc1d5 UTSW 17 50800128 missense probably damaging 1.00
R3898:Tbc1d5 UTSW 17 50963744 missense probably damaging 0.98
R4116:Tbc1d5 UTSW 17 50920587 missense probably damaging 1.00
R4352:Tbc1d5 UTSW 17 50782401 missense probably damaging 0.98
R4456:Tbc1d5 UTSW 17 50782341 missense probably damaging 1.00
R4648:Tbc1d5 UTSW 17 50736223 missense probably benign
R4711:Tbc1d5 UTSW 17 50935509 missense probably damaging 0.98
R4754:Tbc1d5 UTSW 17 50800165 missense probably benign 0.03
R5303:Tbc1d5 UTSW 17 50736200 missense probably benign 0.00
R5360:Tbc1d5 UTSW 17 50984632 missense probably benign 0.26
R5443:Tbc1d5 UTSW 17 50735967 missense probably damaging 0.98
R5444:Tbc1d5 UTSW 17 50735967 missense probably damaging 0.98
R5611:Tbc1d5 UTSW 17 50735967 missense probably damaging 0.98
R5658:Tbc1d5 UTSW 17 50813841 missense probably benign 0.18
R5921:Tbc1d5 UTSW 17 50963693 missense probably damaging 1.00
R6280:Tbc1d5 UTSW 17 50782310 missense probably benign 0.01
R6628:Tbc1d5 UTSW 17 50736208 missense probably benign
R6705:Tbc1d5 UTSW 17 51025175 start gained probably benign
R6990:Tbc1d5 UTSW 17 50968232 missense probably benign 0.19
Z1088:Tbc1d5 UTSW 17 50963696 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGAGATGTTGGTTTCTCACC -3'
(R):5'- AGAGGTGCTCCCCTGAATATAC -3'

Sequencing Primer
(F):5'- GGTTTCTCACCGGCAAGTG -3'
(R):5'- GGTCTCCAACAGCTTGATTAAC -3'
Posted On2017-01-03