Incidental Mutation 'R5713:Abhd18'
ID450984
Institutional Source Beutler Lab
Gene Symbol Abhd18
Ensembl Gene ENSMUSG00000037818
Gene Nameabhydrolase domain containing 18
Synonyms3110057O12Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R5713 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location40846970-40938138 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 40934979 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 431 (Y431*)
Ref Sequence ENSEMBL: ENSMUSP00000124430 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108077] [ENSMUST00000108078] [ENSMUST00000159774] [ENSMUST00000204496] [ENSMUST00000205065]
Predicted Effect probably null
Transcript: ENSMUST00000108077
AA Change: Y431*
SMART Domains Protein: ENSMUSP00000103712
Gene: ENSMUSG00000037818
AA Change: Y431*

DomainStartEndE-ValueType
Pfam:DUF2048 16 457 7.7e-168 PFAM
Pfam:Abhydrolase_6 91 445 1.4e-7 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000108078
AA Change: Y431*
SMART Domains Protein: ENSMUSP00000103713
Gene: ENSMUSG00000037818
AA Change: Y431*

DomainStartEndE-ValueType
Pfam:DUF2048 16 457 7.7e-168 PFAM
Pfam:Abhydrolase_6 91 445 1.4e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159057
AA Change: S226T
Predicted Effect probably null
Transcript: ENSMUST00000159774
AA Change: Y431*
SMART Domains Protein: ENSMUSP00000124430
Gene: ENSMUSG00000037818
AA Change: Y431*

DomainStartEndE-ValueType
Pfam:DUF2048 16 457 1.3e-171 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204464
Predicted Effect probably benign
Transcript: ENSMUST00000204496
SMART Domains Protein: ENSMUSP00000145007
Gene: ENSMUSG00000037818

DomainStartEndE-ValueType
Pfam:DUF2048 16 67 2.2e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205065
SMART Domains Protein: ENSMUSP00000145095
Gene: ENSMUSG00000037818

DomainStartEndE-ValueType
Pfam:DUF2048 16 151 7.8e-65 PFAM
Meta Mutation Damage Score 0.6372 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 98% (56/57)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aqp7 G A 4: 41,035,510 T115I probably benign Het
Arid1b C A 17: 5,336,816 R1515S probably damaging Het
Atp5g3 A G 2: 73,909,307 V63A probably benign Het
Bmp6 C T 13: 38,498,952 P473S probably damaging Het
Btbd11 A T 10: 85,651,652 I995F probably damaging Het
Casp3 C A 8: 46,636,314 T199K probably damaging Het
Ccl3 C T 11: 83,649,240 C13Y possibly damaging Het
Cdc42bpa T C 1: 180,084,410 S518P probably benign Het
Clic3 A T 2: 25,458,167 I109F probably damaging Het
Dnah9 T A 11: 66,025,223 D2301V possibly damaging Het
Gm26627 A G 6: 29,507,851 probably benign Het
Gm4887 A T 7: 104,821,793 noncoding transcript Het
Hc A C 2: 35,013,531 I1037S probably damaging Het
Il2rb A G 15: 78,491,848 M1T probably null Het
Ing5 T A 1: 93,812,730 D124E probably benign Het
Jak2 A G 19: 29,271,393 E90G probably damaging Het
Kalrn A T 16: 34,016,579 I522N probably benign Het
Lipa A T 19: 34,523,432 H71Q probably benign Het
Lmnb2 C T 10: 80,906,087 V57M probably damaging Het
Mllt3 A T 4: 87,841,211 M200K probably benign Het
Mtpap G A 18: 4,396,280 S524N probably benign Het
Mup21 C G 4: 62,150,274 E52Q probably damaging Het
Nasp A G 4: 116,614,361 F90L probably benign Het
Nr1d1 T C 11: 98,770,411 D343G probably benign Het
Otop2 T A 11: 115,329,044 F237I probably damaging Het
Pax4 A G 6: 28,446,185 I103T probably damaging Het
Pde4a T A 9: 21,203,517 S430T probably damaging Het
Phf20l1 A G 15: 66,636,820 N843D possibly damaging Het
Pla2g7 T A 17: 43,594,292 M37K probably benign Het
Plcb3 T C 19: 6,957,692 I864V probably damaging Het
Prr16 A G 18: 51,302,838 T130A probably damaging Het
Rbm24 A G 13: 46,429,304 D233G probably damaging Het
Rps29 C A 12: 69,158,728 R32L probably benign Het
Serpind1 A G 16: 17,336,987 E226G probably damaging Het
Siglecg A T 7: 43,408,802 I38F probably damaging Het
Slc26a8 T A 17: 28,661,879 M308L probably benign Het
Supv3l1 A G 10: 62,430,504 V631A possibly damaging Het
Tcf12 T C 9: 71,885,263 *58W probably null Het
Tcrg-C2 T A 13: 19,307,345 probably benign Het
Usp34 T A 11: 23,343,515 V203E possibly damaging Het
Vmn2r108 A G 17: 20,471,028 L411P probably damaging Het
Zfp874a A T 13: 67,449,357 D42E probably benign Het
Other mutations in Abhd18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01319:Abhd18 APN 3 40933642 missense probably benign 0.00
IGL01785:Abhd18 APN 3 40905904 missense probably damaging 1.00
IGL02318:Abhd18 APN 3 40930227 critical splice donor site probably null
IGL02447:Abhd18 APN 3 40933773 missense probably benign
IGL02823:Abhd18 APN 3 40933518 splice site probably benign
IGL03023:Abhd18 APN 3 40904984 missense probably damaging 0.98
F2404:Abhd18 UTSW 3 40933878 missense probably damaging 0.99
R0064:Abhd18 UTSW 3 40933853 missense probably benign 0.00
R0064:Abhd18 UTSW 3 40933853 missense probably benign 0.00
R0494:Abhd18 UTSW 3 40916688 missense probably damaging 1.00
R1994:Abhd18 UTSW 3 40934926 nonsense probably null
R2206:Abhd18 UTSW 3 40910573 missense probably benign 0.00
R2223:Abhd18 UTSW 3 40934861 splice site probably benign
R2698:Abhd18 UTSW 3 40930966 missense probably benign 0.03
R3406:Abhd18 UTSW 3 40904903 start codon destroyed probably null 1.00
R3747:Abhd18 UTSW 3 40933573 missense probably benign
R4899:Abhd18 UTSW 3 40905869 splice site probably null
R5259:Abhd18 UTSW 3 40916890 missense probably damaging 1.00
R5673:Abhd18 UTSW 3 40923451 missense probably damaging 1.00
R5797:Abhd18 UTSW 3 40933551 missense probably benign 0.08
R5983:Abhd18 UTSW 3 40910544 missense probably damaging 1.00
R6333:Abhd18 UTSW 3 40933783 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTCCACTAGACTGGCTTGGC -3'
(R):5'- ACATGAAGAAACAGCTCAGTGTAC -3'

Sequencing Primer
(F):5'- TGAACTTGTAGCCTCCCAAGTAG -3'
(R):5'- CTTGCTGGCCTTCATATATT -3'
Posted On2017-01-03