Incidental Mutation 'R5713:Siglecg'
ID450991
Institutional Source Beutler Lab
Gene Symbol Siglecg
Ensembl Gene ENSMUSG00000030468
Gene Namesialic acid binding Ig-like lectin G
SynonymsmSiglec-G, A630096C01Rik
MMRRC Submission 043335-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R5713 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location43408204-43418358 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 43408802 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 38 (I38F)
Ref Sequence ENSEMBL: ENSMUSP00000005592 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005592]
Predicted Effect probably damaging
Transcript: ENSMUST00000005592
AA Change: I38F

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000005592
Gene: ENSMUSG00000030468
AA Change: I38F

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
IG 27 139 5.21e-2 SMART
IG_like 148 232 8.97e0 SMART
IGc2 262 325 3.38e-10 SMART
IGc2 366 427 8.26e-5 SMART
low complexity region 473 480 N/A INTRINSIC
transmembrane domain 545 564 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123042
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124502
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124885
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131744
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154322
Meta Mutation Damage Score 0.128 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SIGLECs are members of the immunoglobulin superfamily that are expressed on the cell surface. Most SIGLECs have 1 or more cytoplasmic immune receptor tyrosine-based inhibitory motifs, or ITIMs. SIGLECs are typically expressed on cells of the innate immune system, with the exception of the B-cell expressed SIGLEC6 (MIM 604405).[supplied by OMIM, Jul 2002]
PHENOTYPE: Mice homozygous for a null allele exhibit increased B-1 cell numbers, increased IgM levels and IgM-producing plasma cells, and produce more IgM autoantibodies. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd18 T A 3: 40,934,979 Y431* probably null Het
Aqp7 G A 4: 41,035,510 T115I probably benign Het
Arid1b C A 17: 5,336,816 R1515S probably damaging Het
Atp5g3 A G 2: 73,909,307 V63A probably benign Het
Bmp6 C T 13: 38,498,952 P473S probably damaging Het
Btbd11 A T 10: 85,651,652 I995F probably damaging Het
Casp3 C A 8: 46,636,314 T199K probably damaging Het
Ccl3 C T 11: 83,649,240 C13Y possibly damaging Het
Cdc42bpa T C 1: 180,084,410 S518P probably benign Het
Clic3 A T 2: 25,458,167 I109F probably damaging Het
Dnah9 T A 11: 66,025,223 D2301V possibly damaging Het
Gm26627 A G 6: 29,507,851 probably benign Het
Gm4887 A T 7: 104,821,793 noncoding transcript Het
Hc A C 2: 35,013,531 I1037S probably damaging Het
Il2rb A G 15: 78,491,848 M1T probably null Het
Ing5 T A 1: 93,812,730 D124E probably benign Het
Jak2 A G 19: 29,271,393 E90G probably damaging Het
Kalrn A T 16: 34,016,579 I522N probably benign Het
Lipa A T 19: 34,523,432 H71Q probably benign Het
Lmnb2 C T 10: 80,906,087 V57M probably damaging Het
Mllt3 A T 4: 87,841,211 M200K probably benign Het
Mtpap G A 18: 4,396,280 S524N probably benign Het
Mup21 C G 4: 62,150,274 E52Q probably damaging Het
Nasp A G 4: 116,614,361 F90L probably benign Het
Nr1d1 T C 11: 98,770,411 D343G probably benign Het
Otop2 T A 11: 115,329,044 F237I probably damaging Het
Pax4 A G 6: 28,446,185 I103T probably damaging Het
Pde4a T A 9: 21,203,517 S430T probably damaging Het
Phf20l1 A G 15: 66,636,820 N843D possibly damaging Het
Pla2g7 T A 17: 43,594,292 M37K probably benign Het
Plcb3 T C 19: 6,957,692 I864V probably damaging Het
Prr16 A G 18: 51,302,838 T130A probably damaging Het
Rbm24 A G 13: 46,429,304 D233G probably damaging Het
Rps29 C A 12: 69,158,728 R32L probably benign Het
Serpind1 A G 16: 17,336,987 E226G probably damaging Het
Slc26a8 T A 17: 28,661,879 M308L probably benign Het
Supv3l1 A G 10: 62,430,504 V631A possibly damaging Het
Tcf12 T C 9: 71,885,263 *58W probably null Het
Tcrg-C2 T A 13: 19,307,345 probably benign Het
Usp34 T A 11: 23,343,515 V203E possibly damaging Het
Vmn2r108 A G 17: 20,471,028 L411P probably damaging Het
Zfp874a A T 13: 67,449,357 D42E probably benign Het
Other mutations in Siglecg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00528:Siglecg APN 7 43409057 missense possibly damaging 0.64
IGL00556:Siglecg APN 7 43411795 missense probably benign 0.02
IGL01806:Siglecg APN 7 43411464 splice site probably null
IGL01947:Siglecg APN 7 43408763 missense probably benign 0.43
IGL02257:Siglecg APN 7 43411904 missense probably benign 0.00
IGL02410:Siglecg APN 7 43408829 missense probably damaging 0.99
IGL02454:Siglecg APN 7 43408895 missense probably benign 0.00
Chamonix UTSW 7 43409422 missense possibly damaging 0.91
Montblanc UTSW 7 43411386 intron probably benign
Shenandoah UTSW 7 43408802 missense probably damaging 0.99
shenandoah2 UTSW 7 43412017 missense possibly damaging 0.82
Sherando UTSW 7 43409057 missense possibly damaging 0.64
IGL02988:Siglecg UTSW 7 43418052 missense probably damaging 1.00
R0134:Siglecg UTSW 7 43411171 missense probably damaging 1.00
R0225:Siglecg UTSW 7 43411171 missense probably damaging 1.00
R0480:Siglecg UTSW 7 43411126 missense probably benign 0.42
R1538:Siglecg UTSW 7 43417889 missense possibly damaging 0.53
R1681:Siglecg UTSW 7 43408941 missense probably benign 0.17
R2358:Siglecg UTSW 7 43409422 missense possibly damaging 0.91
R4428:Siglecg UTSW 7 43417926 missense possibly damaging 0.84
R4429:Siglecg UTSW 7 43417926 missense possibly damaging 0.84
R4736:Siglecg UTSW 7 43417908 missense probably benign 0.03
R4754:Siglecg UTSW 7 43411871 intron probably benign
R5017:Siglecg UTSW 7 43411386 intron probably benign
R5777:Siglecg UTSW 7 43409413 missense possibly damaging 0.80
R5892:Siglecg UTSW 7 43412204 intron probably benign
R6153:Siglecg UTSW 7 43412017 missense possibly damaging 0.82
R6154:Siglecg UTSW 7 43412017 missense possibly damaging 0.82
R6331:Siglecg UTSW 7 43408754 missense possibly damaging 0.83
R6562:Siglecg UTSW 7 43409057 missense possibly damaging 0.64
R6749:Siglecg UTSW 7 43408979 missense probably benign 0.00
R7066:Siglecg UTSW 7 43411742 missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- GATGTCACTGCTGCTGTTCC -3'
(R):5'- TTGAGTCTCCCCACTGAACATC -3'

Sequencing Primer
(F):5'- CCAGAGTGGCTCAAATTGGG -3'
(R):5'- TTTAGAGATATCCCCCAAGAGCTGG -3'
Posted On2017-01-03