Incidental Mutation 'R5713:Casp3'
ID450995
Institutional Source Beutler Lab
Gene Symbol Casp3
Ensembl Gene ENSMUSG00000031628
Gene Namecaspase 3
Synonymsmldy, Yama, Caspase-3, Apopain, CPP32, A830040C14Rik, CC3, AC-3
MMRRC Submission 043335-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5713 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location46617291-46639689 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 46636314 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 199 (T199K)
Ref Sequence ENSEMBL: ENSMUSP00000147767 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093517] [ENSMUST00000210534] [ENSMUST00000211115]
Predicted Effect probably damaging
Transcript: ENSMUST00000093517
AA Change: T199K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000091238
Gene: ENSMUSG00000031628
AA Change: T199K

DomainStartEndE-ValueType
CASc 36 277 9.95e-143 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209668
Predicted Effect probably benign
Transcript: ENSMUST00000210534
Predicted Effect probably damaging
Transcript: ENSMUST00000211115
AA Change: T199K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.504 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: This gene encodes a protein that belongs to a highly conserved family of cysteinyl aspartate-specific proteases that function as essential regulators of programmed cell death through apoptosis. Members of this family contain an N-terminal pro-domain and require cleavage at specific aspartate residues to become mature. The protein encoded by this gene belongs to a subgroup of cysteinyl aspartate-specific proteases that are activated by initiator caspases and that perform the proteolytic cleavage of apoptotic target proteins. Mice defective for this gene exhibit a variety of phenotypes including reduced neuronal apoptosis resulting in hyperplasias, hearing loss, attenuated osteogenic differentiation of bone marrow stromal stem cells, and pre- and post-natal lethality. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
PHENOTYPE: Some homozygous animals show defects in brain development by embryonic day 12, reduced neuronal apoptosis causing hyperplasias, and pre- and postnatal lethality. Other homozygous animals exhibit only hearing loss, inner ear defects and degeneration of spiral ganglion neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd18 T A 3: 40,934,979 Y431* probably null Het
Aqp7 G A 4: 41,035,510 T115I probably benign Het
Arid1b C A 17: 5,336,816 R1515S probably damaging Het
Atp5g3 A G 2: 73,909,307 V63A probably benign Het
Bmp6 C T 13: 38,498,952 P473S probably damaging Het
Btbd11 A T 10: 85,651,652 I995F probably damaging Het
Ccl3 C T 11: 83,649,240 C13Y possibly damaging Het
Cdc42bpa T C 1: 180,084,410 S518P probably benign Het
Clic3 A T 2: 25,458,167 I109F probably damaging Het
Dnah9 T A 11: 66,025,223 D2301V possibly damaging Het
Gm26627 A G 6: 29,507,851 probably benign Het
Gm4887 A T 7: 104,821,793 noncoding transcript Het
Hc A C 2: 35,013,531 I1037S probably damaging Het
Il2rb A G 15: 78,491,848 M1T probably null Het
Ing5 T A 1: 93,812,730 D124E probably benign Het
Jak2 A G 19: 29,271,393 E90G probably damaging Het
Kalrn A T 16: 34,016,579 I522N probably benign Het
Lipa A T 19: 34,523,432 H71Q probably benign Het
Lmnb2 C T 10: 80,906,087 V57M probably damaging Het
Mllt3 A T 4: 87,841,211 M200K probably benign Het
Mtpap G A 18: 4,396,280 S524N probably benign Het
Mup21 C G 4: 62,150,274 E52Q probably damaging Het
Nasp A G 4: 116,614,361 F90L probably benign Het
Nr1d1 T C 11: 98,770,411 D343G probably benign Het
Otop2 T A 11: 115,329,044 F237I probably damaging Het
Pax4 A G 6: 28,446,185 I103T probably damaging Het
Pde4a T A 9: 21,203,517 S430T probably damaging Het
Phf20l1 A G 15: 66,636,820 N843D possibly damaging Het
Pla2g7 T A 17: 43,594,292 M37K probably benign Het
Plcb3 T C 19: 6,957,692 I864V probably damaging Het
Prr16 A G 18: 51,302,838 T130A probably damaging Het
Rbm24 A G 13: 46,429,304 D233G probably damaging Het
Rps29 C A 12: 69,158,728 R32L probably benign Het
Serpind1 A G 16: 17,336,987 E226G probably damaging Het
Siglecg A T 7: 43,408,802 I38F probably damaging Het
Slc26a8 T A 17: 28,661,879 M308L probably benign Het
Supv3l1 A G 10: 62,430,504 V631A possibly damaging Het
Tcf12 T C 9: 71,885,263 *58W probably null Het
Tcrg-C2 T A 13: 19,307,345 probably benign Het
Usp34 T A 11: 23,343,515 V203E possibly damaging Het
Vmn2r108 A G 17: 20,471,028 L411P probably damaging Het
Zfp874a A T 13: 67,449,357 D42E probably benign Het
Other mutations in Casp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01753:Casp3 APN 8 46629741 utr 5 prime probably benign
warner UTSW 8 46635388 missense probably damaging 1.00
R0601:Casp3 UTSW 8 46636227 missense probably benign 0.00
R1541:Casp3 UTSW 8 46634334 missense probably benign 0.02
R1648:Casp3 UTSW 8 46638074 missense probably benign
R2046:Casp3 UTSW 8 46629726 splice site probably benign
R2159:Casp3 UTSW 8 46634288 missense probably damaging 1.00
R2176:Casp3 UTSW 8 46629756 missense probably damaging 1.00
R2251:Casp3 UTSW 8 46637955 missense probably damaging 0.98
R2252:Casp3 UTSW 8 46637955 missense probably damaging 0.98
R2253:Casp3 UTSW 8 46637955 missense probably damaging 0.98
R4095:Casp3 UTSW 8 46634216 missense probably damaging 1.00
R4209:Casp3 UTSW 8 46635388 missense probably damaging 1.00
R4211:Casp3 UTSW 8 46635388 missense probably damaging 1.00
R4868:Casp3 UTSW 8 46634279 missense probably benign 0.01
R6847:Casp3 UTSW 8 46636266 missense probably benign 0.00
R6957:Casp3 UTSW 8 46634273 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGACCACACTTAGAGTTTTCAGA -3'
(R):5'- GGTTTACACCCACAAACAACTG -3'

Sequencing Primer
(F):5'- AGAGTTTTCAGATGTAAACTGTGTG -3'
(R):5'- TGGAGATGTAAGCCTACACCTGTC -3'
Posted On2017-01-03