Incidental Mutation 'R5713:Btbd11'
ID451001
Institutional Source Beutler Lab
Gene Symbol Btbd11
Ensembl Gene ENSMUSG00000020042
Gene NameBTB (POZ) domain containing 11
Synonyms6330404E16Rik
MMRRC Submission 043335-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.459) question?
Stock #R5713 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location85386814-85660292 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 85651652 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 995 (I995F)
Ref Sequence ENSEMBL: ENSMUSP00000100944 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105306] [ENSMUST00000105307]
Predicted Effect probably damaging
Transcript: ENSMUST00000105306
AA Change: I526F

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000100943
Gene: ENSMUSG00000020042
AA Change: I526F

DomainStartEndE-ValueType
ANK 139 168 2.74e-7 SMART
ANK 185 214 7.3e-3 SMART
ANK 223 252 1.05e-3 SMART
ANK 266 296 2.21e3 SMART
BTB 459 558 5.38e-21 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000105307
AA Change: I995F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000100944
Gene: ENSMUSG00000020042
AA Change: I995F

DomainStartEndE-ValueType
low complexity region 101 109 N/A INTRINSIC
low complexity region 174 194 N/A INTRINSIC
Blast:H2A 195 261 5e-37 BLAST
low complexity region 262 285 N/A INTRINSIC
low complexity region 292 344 N/A INTRINSIC
Blast:H2A 350 384 1e-15 BLAST
ANK 608 637 2.74e-7 SMART
ANK 654 683 7.3e-3 SMART
ANK 692 721 1.05e-3 SMART
ANK 735 765 2.21e3 SMART
BTB 928 1027 5.38e-21 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128338
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145433
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156123
Meta Mutation Damage Score 0.168 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 98% (56/57)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd18 T A 3: 40,934,979 Y431* probably null Het
Aqp7 G A 4: 41,035,510 T115I probably benign Het
Arid1b C A 17: 5,336,816 R1515S probably damaging Het
Atp5g3 A G 2: 73,909,307 V63A probably benign Het
Bmp6 C T 13: 38,498,952 P473S probably damaging Het
Casp3 C A 8: 46,636,314 T199K probably damaging Het
Ccl3 C T 11: 83,649,240 C13Y possibly damaging Het
Cdc42bpa T C 1: 180,084,410 S518P probably benign Het
Clic3 A T 2: 25,458,167 I109F probably damaging Het
Dnah9 T A 11: 66,025,223 D2301V possibly damaging Het
Gm26627 A G 6: 29,507,851 probably benign Het
Gm4887 A T 7: 104,821,793 noncoding transcript Het
Hc A C 2: 35,013,531 I1037S probably damaging Het
Il2rb A G 15: 78,491,848 M1T probably null Het
Ing5 T A 1: 93,812,730 D124E probably benign Het
Jak2 A G 19: 29,271,393 E90G probably damaging Het
Kalrn A T 16: 34,016,579 I522N probably benign Het
Lipa A T 19: 34,523,432 H71Q probably benign Het
Lmnb2 C T 10: 80,906,087 V57M probably damaging Het
Mllt3 A T 4: 87,841,211 M200K probably benign Het
Mtpap G A 18: 4,396,280 S524N probably benign Het
Mup21 C G 4: 62,150,274 E52Q probably damaging Het
Nasp A G 4: 116,614,361 F90L probably benign Het
Nr1d1 T C 11: 98,770,411 D343G probably benign Het
Otop2 T A 11: 115,329,044 F237I probably damaging Het
Pax4 A G 6: 28,446,185 I103T probably damaging Het
Pde4a T A 9: 21,203,517 S430T probably damaging Het
Phf20l1 A G 15: 66,636,820 N843D possibly damaging Het
Pla2g7 T A 17: 43,594,292 M37K probably benign Het
Plcb3 T C 19: 6,957,692 I864V probably damaging Het
Prr16 A G 18: 51,302,838 T130A probably damaging Het
Rbm24 A G 13: 46,429,304 D233G probably damaging Het
Rps29 C A 12: 69,158,728 R32L probably benign Het
Serpind1 A G 16: 17,336,987 E226G probably damaging Het
Siglecg A T 7: 43,408,802 I38F probably damaging Het
Slc26a8 T A 17: 28,661,879 M308L probably benign Het
Supv3l1 A G 10: 62,430,504 V631A possibly damaging Het
Tcf12 T C 9: 71,885,263 *58W probably null Het
Tcrg-C2 T A 13: 19,307,345 probably benign Het
Usp34 T A 11: 23,343,515 V203E possibly damaging Het
Vmn2r108 A G 17: 20,471,028 L411P probably damaging Het
Zfp874a A T 13: 67,449,357 D42E probably benign Het
Other mutations in Btbd11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00666:Btbd11 APN 10 85629216 missense possibly damaging 0.87
IGL01143:Btbd11 APN 10 85654471 splice site probably benign
IGL01365:Btbd11 APN 10 85633816 missense possibly damaging 0.75
IGL01409:Btbd11 APN 10 85658165 missense possibly damaging 0.88
IGL01531:Btbd11 APN 10 85629205 splice site probably benign
IGL01593:Btbd11 APN 10 85654475 splice site probably benign
IGL01751:Btbd11 APN 10 85654502 missense probably damaging 1.00
IGL01752:Btbd11 APN 10 85654502 missense probably damaging 1.00
IGL02041:Btbd11 APN 10 85387554 missense unknown
IGL02486:Btbd11 APN 10 85640555 missense probably damaging 1.00
IGL02597:Btbd11 APN 10 85633801 missense probably damaging 1.00
IGL02957:Btbd11 APN 10 85633837 missense probably damaging 1.00
IGL02957:Btbd11 APN 10 85631286 splice site probably benign
IGL02967:Btbd11 APN 10 85633782 missense probably benign 0.11
IGL02975:Btbd11 APN 10 85631343 missense probably benign 0.16
IGL03078:Btbd11 APN 10 85632163 missense probably damaging 1.00
IGL03130:Btbd11 APN 10 85388483 splice site probably null
IGL03335:Btbd11 APN 10 85658358 utr 3 prime probably benign
R0024:Btbd11 UTSW 10 85387447 missense unknown
R0599:Btbd11 UTSW 10 85658336 missense probably damaging 1.00
R0655:Btbd11 UTSW 10 85645526 missense probably damaging 1.00
R0660:Btbd11 UTSW 10 85388370 missense possibly damaging 0.65
R0664:Btbd11 UTSW 10 85388370 missense possibly damaging 0.65
R1155:Btbd11 UTSW 10 85629291 missense probably damaging 1.00
R1244:Btbd11 UTSW 10 85387363 missense unknown
R1389:Btbd11 UTSW 10 85640596 missense possibly damaging 0.76
R1418:Btbd11 UTSW 10 85645578 missense probably damaging 1.00
R1703:Btbd11 UTSW 10 85387384 missense unknown
R1957:Btbd11 UTSW 10 85633699 missense probably damaging 1.00
R2519:Btbd11 UTSW 10 85651611 missense probably damaging 1.00
R3716:Btbd11 UTSW 10 85561528 missense probably damaging 1.00
R3915:Btbd11 UTSW 10 85632270 missense probably damaging 1.00
R4738:Btbd11 UTSW 10 85627248 nonsense probably null
R4782:Btbd11 UTSW 10 85654550 missense probably damaging 1.00
R4846:Btbd11 UTSW 10 85629266 missense probably damaging 1.00
R4887:Btbd11 UTSW 10 85387378 missense unknown
R4960:Btbd11 UTSW 10 85651662 missense probably benign 0.34
R5224:Btbd11 UTSW 10 85645522 small deletion probably benign
R5341:Btbd11 UTSW 10 85387372 missense unknown
R6046:Btbd11 UTSW 10 85388083 missense unknown
R6461:Btbd11 UTSW 10 85640564 missense probably damaging 1.00
R6809:Btbd11 UTSW 10 85631376 missense probably benign 0.01
R7069:Btbd11 UTSW 10 85387656 missense unknown
R7130:Btbd11 UTSW 10 85387555 missense unknown
R7202:Btbd11 UTSW 10 85387765 missense unknown
R7275:Btbd11 UTSW 10 85654482 missense probably damaging 1.00
X0020:Btbd11 UTSW 10 85631352 missense possibly damaging 0.86
Z1088:Btbd11 UTSW 10 85387857 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- CAGGGTGTCATCAGGGAAAC -3'
(R):5'- CAACTCTTCCTGAGAACGTGC -3'

Sequencing Primer
(F):5'- GGAAACCTGTCCAAATGTCCC -3'
(R):5'- GTTAAAACTGGTTTCCACCCAGGG -3'
Posted On2017-01-03