Incidental Mutation 'R5713:Nr1d1'
ID451006
Institutional Source Beutler Lab
Gene Symbol Nr1d1
Ensembl Gene ENSMUSG00000020889
Gene Namenuclear receptor subfamily 1, group D, member 1
SynonymsREV-ERBalpha, rev-erbA(alpha), A530070C09Rik
MMRRC Submission 043335-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5713 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location98767932-98775333 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 98770411 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 343 (D343G)
Ref Sequence ENSEMBL: ENSMUSP00000069505 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064187] [ENSMUST00000064941] [ENSMUST00000124072]
Predicted Effect probably benign
Transcript: ENSMUST00000064187
SMART Domains Protein: ENSMUSP00000068281
Gene: ENSMUSG00000058756

DomainStartEndE-ValueType
ZnF_C4 50 123 3.09e-36 SMART
HOLI 220 378 1.43e-31 SMART
low complexity region 461 484 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000064941
AA Change: D343G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000069505
Gene: ENSMUSG00000020889
AA Change: D343G

DomainStartEndE-ValueType
low complexity region 14 34 N/A INTRINSIC
low complexity region 70 94 N/A INTRINSIC
ZnF_C4 130 202 5.54e-38 SMART
low complexity region 240 263 N/A INTRINSIC
PDB:3N00|A 282 361 2e-21 PDB
HOLI 442 600 4.2e-38 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124072
SMART Domains Protein: ENSMUSP00000115323
Gene: ENSMUSG00000058756

DomainStartEndE-ValueType
ZnF_C4 50 123 3.09e-36 SMART
HOLI 220 378 2.36e-32 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139220
Meta Mutation Damage Score 0.124 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: This gene encodes a transcription factor that is a member of the nuclear receptor subfamily 1. The encoded protein is a ligand-sensitive transcription factor that negatively regulates the expression of core clock proteins. In particular this protein represses the circadian clock transcription factor aryl hydrocarbon receptor nuclear translocator-like protein 1 (Arntl). This protein may also be involved in regulating genes that function in metabolic, inflammatory and cardiovascular processes. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygotes for targeted null mutations exhibit altered circadian behavior and temperature regulation with mild alterations in cytoarchitecture of the cerebellum. Litter size is reduced by half in mutant females. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd18 T A 3: 40,934,979 Y431* probably null Het
Aqp7 G A 4: 41,035,510 T115I probably benign Het
Arid1b C A 17: 5,336,816 R1515S probably damaging Het
Atp5g3 A G 2: 73,909,307 V63A probably benign Het
Bmp6 C T 13: 38,498,952 P473S probably damaging Het
Btbd11 A T 10: 85,651,652 I995F probably damaging Het
Casp3 C A 8: 46,636,314 T199K probably damaging Het
Ccl3 C T 11: 83,649,240 C13Y possibly damaging Het
Cdc42bpa T C 1: 180,084,410 S518P probably benign Het
Clic3 A T 2: 25,458,167 I109F probably damaging Het
Dnah9 T A 11: 66,025,223 D2301V possibly damaging Het
Gm26627 A G 6: 29,507,851 probably benign Het
Gm4887 A T 7: 104,821,793 noncoding transcript Het
Hc A C 2: 35,013,531 I1037S probably damaging Het
Il2rb A G 15: 78,491,848 M1T probably null Het
Ing5 T A 1: 93,812,730 D124E probably benign Het
Jak2 A G 19: 29,271,393 E90G probably damaging Het
Kalrn A T 16: 34,016,579 I522N probably benign Het
Lipa A T 19: 34,523,432 H71Q probably benign Het
Lmnb2 C T 10: 80,906,087 V57M probably damaging Het
Mllt3 A T 4: 87,841,211 M200K probably benign Het
Mtpap G A 18: 4,396,280 S524N probably benign Het
Mup21 C G 4: 62,150,274 E52Q probably damaging Het
Nasp A G 4: 116,614,361 F90L probably benign Het
Otop2 T A 11: 115,329,044 F237I probably damaging Het
Pax4 A G 6: 28,446,185 I103T probably damaging Het
Pde4a T A 9: 21,203,517 S430T probably damaging Het
Phf20l1 A G 15: 66,636,820 N843D possibly damaging Het
Pla2g7 T A 17: 43,594,292 M37K probably benign Het
Plcb3 T C 19: 6,957,692 I864V probably damaging Het
Prr16 A G 18: 51,302,838 T130A probably damaging Het
Rbm24 A G 13: 46,429,304 D233G probably damaging Het
Rps29 C A 12: 69,158,728 R32L probably benign Het
Serpind1 A G 16: 17,336,987 E226G probably damaging Het
Siglecg A T 7: 43,408,802 I38F probably damaging Het
Slc26a8 T A 17: 28,661,879 M308L probably benign Het
Supv3l1 A G 10: 62,430,504 V631A possibly damaging Het
Tcf12 T C 9: 71,885,263 *58W probably null Het
Tcrg-C2 T A 13: 19,307,345 probably benign Het
Usp34 T A 11: 23,343,515 V203E possibly damaging Het
Vmn2r108 A G 17: 20,471,028 L411P probably damaging Het
Zfp874a A T 13: 67,449,357 D42E probably benign Het
Other mutations in Nr1d1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0048:Nr1d1 UTSW 11 98770478 missense probably benign
R1485:Nr1d1 UTSW 11 98770361 missense probably benign
R1801:Nr1d1 UTSW 11 98771499 missense probably damaging 1.00
R2090:Nr1d1 UTSW 11 98770610 missense probably damaging 0.99
R4342:Nr1d1 UTSW 11 98771814 missense probably damaging 1.00
R4622:Nr1d1 UTSW 11 98769884 missense probably damaging 1.00
R4658:Nr1d1 UTSW 11 98771912 missense possibly damaging 0.80
R4664:Nr1d1 UTSW 11 98771260 missense possibly damaging 0.95
R4770:Nr1d1 UTSW 11 98770645 missense probably benign 0.28
R5408:Nr1d1 UTSW 11 98770261 missense probably benign 0.02
R5677:Nr1d1 UTSW 11 98771308 missense probably damaging 1.00
R6244:Nr1d1 UTSW 11 98770537 missense probably damaging 1.00
R6429:Nr1d1 UTSW 11 98772014 missense probably damaging 1.00
R6875:Nr1d1 UTSW 11 98770836 splice site probably null
R7073:Nr1d1 UTSW 11 98772066 missense probably damaging 0.99
R7100:Nr1d1 UTSW 11 98771334 missense probably damaging 1.00
X0018:Nr1d1 UTSW 11 98770829 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCAGAACATTCTTGGTGTTGC -3'
(R):5'- CCACCATGGAGGATGTGATATC -3'

Sequencing Primer
(F):5'- CCTTGCCGTAGACTGTTGGC -3'
(R):5'- ATGTGATATCCCAGGTCGCC -3'
Posted On2017-01-03