Incidental Mutation 'R5713:Rps29'
ID451008
Institutional Source Beutler Lab
Gene Symbol Rps29
Ensembl Gene ENSMUSG00000034892
Gene Nameribosomal protein S29
SynonymsS29 ribosomal protein
MMRRC Submission 043335-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.930) question?
Stock #R5713 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location69157722-69159186 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 69158728 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 32 (R32L)
Ref Sequence ENSEMBL: ENSMUSP00000038352 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037023]
Predicted Effect probably benign
Transcript: ENSMUST00000037023
AA Change: R32L

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000038352
Gene: ENSMUSG00000034892
AA Change: R32L

DomainStartEndE-ValueType
Pfam:Ribosomal_S14 4 56 8.3e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000094291
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174924
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196389
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200493
Meta Mutation Damage Score 0.31 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 40S subunit and a member of the S14P family of ribosomal proteins. The protein, which contains a C2-C2 zinc finger-like domain that can bind to zinc, can enhance the tumor suppressor activity of Ras-related protein 1A (KREV1). It is located in the cytoplasm. Variable expression of this gene in colorectal cancers compared to adjacent normal tissues has been observed, although no correlation between the level of expression and the severity of the disease has been found. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2013]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd18 T A 3: 40,934,979 Y431* probably null Het
Aqp7 G A 4: 41,035,510 T115I probably benign Het
Arid1b C A 17: 5,336,816 R1515S probably damaging Het
Atp5g3 A G 2: 73,909,307 V63A probably benign Het
Bmp6 C T 13: 38,498,952 P473S probably damaging Het
Btbd11 A T 10: 85,651,652 I995F probably damaging Het
Casp3 C A 8: 46,636,314 T199K probably damaging Het
Ccl3 C T 11: 83,649,240 C13Y possibly damaging Het
Cdc42bpa T C 1: 180,084,410 S518P probably benign Het
Clic3 A T 2: 25,458,167 I109F probably damaging Het
Dnah9 T A 11: 66,025,223 D2301V possibly damaging Het
Gm26627 A G 6: 29,507,851 probably benign Het
Gm4887 A T 7: 104,821,793 noncoding transcript Het
Hc A C 2: 35,013,531 I1037S probably damaging Het
Il2rb A G 15: 78,491,848 M1T probably null Het
Ing5 T A 1: 93,812,730 D124E probably benign Het
Jak2 A G 19: 29,271,393 E90G probably damaging Het
Kalrn A T 16: 34,016,579 I522N probably benign Het
Lipa A T 19: 34,523,432 H71Q probably benign Het
Lmnb2 C T 10: 80,906,087 V57M probably damaging Het
Mllt3 A T 4: 87,841,211 M200K probably benign Het
Mtpap G A 18: 4,396,280 S524N probably benign Het
Mup21 C G 4: 62,150,274 E52Q probably damaging Het
Nasp A G 4: 116,614,361 F90L probably benign Het
Nr1d1 T C 11: 98,770,411 D343G probably benign Het
Otop2 T A 11: 115,329,044 F237I probably damaging Het
Pax4 A G 6: 28,446,185 I103T probably damaging Het
Pde4a T A 9: 21,203,517 S430T probably damaging Het
Phf20l1 A G 15: 66,636,820 N843D possibly damaging Het
Pla2g7 T A 17: 43,594,292 M37K probably benign Het
Plcb3 T C 19: 6,957,692 I864V probably damaging Het
Prr16 A G 18: 51,302,838 T130A probably damaging Het
Rbm24 A G 13: 46,429,304 D233G probably damaging Het
Serpind1 A G 16: 17,336,987 E226G probably damaging Het
Siglecg A T 7: 43,408,802 I38F probably damaging Het
Slc26a8 T A 17: 28,661,879 M308L probably benign Het
Supv3l1 A G 10: 62,430,504 V631A possibly damaging Het
Tcf12 T C 9: 71,885,263 *58W probably null Het
Tcrg-C2 T A 13: 19,307,345 probably benign Het
Usp34 T A 11: 23,343,515 V203E possibly damaging Het
Vmn2r108 A G 17: 20,471,028 L411P probably damaging Het
Zfp874a A T 13: 67,449,357 D42E probably benign Het
Other mutations in Rps29
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02900:Rps29 APN 12 69159051 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGTAGAAACTGCACCACCTC -3'
(R):5'- GGTGTCGGAAATTCAAGGCC -3'

Sequencing Primer
(F):5'- TACCCACCTGACACCTAAATCTG -3'
(R):5'- AAATTCAAGGCCCGCGG -3'
Posted On2017-01-03