Incidental Mutation 'R5713:Pla2g7'
ID451021
Institutional Source Beutler Lab
Gene Symbol Pla2g7
Ensembl Gene ENSMUSG00000023913
Gene Namephospholipase A2, group VII (platelet-activating factor acetylhydrolase, plasma)
SynonymsPAF acetylhydrolase
MMRRC Submission 043335-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.451) question?
Stock #R5713 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location43568098-43612201 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 43594292 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 37 (M37K)
Ref Sequence ENSEMBL: ENSMUSP00000131898 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024706] [ENSMUST00000167214] [ENSMUST00000167418] [ENSMUST00000169694]
Predicted Effect probably benign
Transcript: ENSMUST00000024706
AA Change: M37K

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000024706
Gene: ENSMUSG00000023913
AA Change: M37K

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:PAF-AH_p_II 47 415 6e-179 PFAM
Pfam:Abhydrolase_5 145 351 3.2e-18 PFAM
Pfam:Abhydrolase_1 215 318 2.8e-7 PFAM
Pfam:Peptidase_S9 247 356 2e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163489
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164150
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165706
Predicted Effect probably benign
Transcript: ENSMUST00000167214
AA Change: M37K

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000130404
Gene: ENSMUSG00000023913
AA Change: M37K

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:PAF-AH_p_II 47 210 7.9e-71 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167418
AA Change: M37K

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000131898
Gene: ENSMUSG00000023913
AA Change: M37K

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:PAF-AH_p_II 47 122 1e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167672
Predicted Effect probably benign
Transcript: ENSMUST00000169694
AA Change: M37K

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000132027
Gene: ENSMUSG00000023913
AA Change: M37K

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:PAF-AH_p_II 47 298 6.1e-120 PFAM
Pfam:Abhydrolase_5 145 298 1.4e-15 PFAM
Pfam:Abhydrolase_6 146 298 4.5e-11 PFAM
Pfam:Peptidase_S9 246 298 4.1e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169733
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172072
Meta Mutation Damage Score 0.08 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a secreted enzyme that catalyzes the degradation of platelet-activating factor to biologically inactive products. Defects in this gene are a cause of platelet-activating factor acetylhydrolase deficiency. Two transcript variants encoding the same protein have been found for this gene.[provided by RefSeq, Dec 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced early mortality in response to bacterial exposure, formula feeding and asphyxia, but survivors show a significantly higher incidence of necrotizing enterocolitis relative to wild-type controls. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd18 T A 3: 40,934,979 Y431* probably null Het
Aqp7 G A 4: 41,035,510 T115I probably benign Het
Arid1b C A 17: 5,336,816 R1515S probably damaging Het
Atp5g3 A G 2: 73,909,307 V63A probably benign Het
Bmp6 C T 13: 38,498,952 P473S probably damaging Het
Btbd11 A T 10: 85,651,652 I995F probably damaging Het
Casp3 C A 8: 46,636,314 T199K probably damaging Het
Ccl3 C T 11: 83,649,240 C13Y possibly damaging Het
Cdc42bpa T C 1: 180,084,410 S518P probably benign Het
Clic3 A T 2: 25,458,167 I109F probably damaging Het
Dnah9 T A 11: 66,025,223 D2301V possibly damaging Het
Gm26627 A G 6: 29,507,851 probably benign Het
Gm4887 A T 7: 104,821,793 noncoding transcript Het
Hc A C 2: 35,013,531 I1037S probably damaging Het
Il2rb A G 15: 78,491,848 M1T probably null Het
Ing5 T A 1: 93,812,730 D124E probably benign Het
Jak2 A G 19: 29,271,393 E90G probably damaging Het
Kalrn A T 16: 34,016,579 I522N probably benign Het
Lipa A T 19: 34,523,432 H71Q probably benign Het
Lmnb2 C T 10: 80,906,087 V57M probably damaging Het
Mllt3 A T 4: 87,841,211 M200K probably benign Het
Mtpap G A 18: 4,396,280 S524N probably benign Het
Mup21 C G 4: 62,150,274 E52Q probably damaging Het
Nasp A G 4: 116,614,361 F90L probably benign Het
Nr1d1 T C 11: 98,770,411 D343G probably benign Het
Otop2 T A 11: 115,329,044 F237I probably damaging Het
Pax4 A G 6: 28,446,185 I103T probably damaging Het
Pde4a T A 9: 21,203,517 S430T probably damaging Het
Phf20l1 A G 15: 66,636,820 N843D possibly damaging Het
Plcb3 T C 19: 6,957,692 I864V probably damaging Het
Prr16 A G 18: 51,302,838 T130A probably damaging Het
Rbm24 A G 13: 46,429,304 D233G probably damaging Het
Rps29 C A 12: 69,158,728 R32L probably benign Het
Serpind1 A G 16: 17,336,987 E226G probably damaging Het
Siglecg A T 7: 43,408,802 I38F probably damaging Het
Slc26a8 T A 17: 28,661,879 M308L probably benign Het
Supv3l1 A G 10: 62,430,504 V631A possibly damaging Het
Tcf12 T C 9: 71,885,263 *58W probably null Het
Tcrg-C2 T A 13: 19,307,345 probably benign Het
Usp34 T A 11: 23,343,515 V203E possibly damaging Het
Vmn2r108 A G 17: 20,471,028 L411P probably damaging Het
Zfp874a A T 13: 67,449,357 D42E probably benign Het
Other mutations in Pla2g7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00773:Pla2g7 APN 17 43602871 missense probably damaging 1.00
R0026:Pla2g7 UTSW 17 43594930 splice site probably benign
R0421:Pla2g7 UTSW 17 43611412 missense probably damaging 0.96
R1701:Pla2g7 UTSW 17 43600524 missense probably damaging 1.00
R4591:Pla2g7 UTSW 17 43600559 missense probably damaging 0.98
R5100:Pla2g7 UTSW 17 43611376 missense probably damaging 1.00
R6404:Pla2g7 UTSW 17 43594797 missense probably damaging 1.00
R6433:Pla2g7 UTSW 17 43599126 missense probably damaging 1.00
R7180:Pla2g7 UTSW 17 43599076 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAGCAGGCCTTTGAGTGG -3'
(R):5'- GCCGGTTAGTCATTCTCAGGAG -3'

Sequencing Primer
(F):5'- ACCCATGTAAAACTGGGTGTCTGTC -3'
(R):5'- GCTACCACCTGTGCTAGAAAG -3'
Posted On2017-01-03